ID: 1164284518

View in Genome Browser
Species Human (GRCh38)
Location 19:23801237-23801259
Sequence TTTTTTTAGGGGAGGGTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1475
Summary {0: 1, 1: 1, 2: 18, 3: 158, 4: 1297}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164284518 Original CRISPR TTTTTTTAGGGGAGGGTTGG GGG Intronic
900132634 1:1094094-1094116 TTTTTTTTTGGCAGGGGTGGGGG + Intronic
901024162 1:6270288-6270310 TGTTTTTAATGGAGGGTTGGGGG + Intronic
901336650 1:8454994-8455016 TCATTTTTGGGGTGGGTTGGTGG - Intronic
901348772 1:8572751-8572773 ATTTTAGAGGAGAGGGTTGGGGG - Intronic
901827575 1:11872351-11872373 TTTTTTGGTGGGGGGGTTGGGGG + Intergenic
902252517 1:15163821-15163843 TTTTTTTGGGGGGGGGGAGGGGG + Intronic
902434478 1:16389260-16389282 TTTTTTTGAGGGGGGGTGGGGGG + Intronic
902452281 1:16504541-16504563 TTTTTTTAGGCCAGGTGTGGTGG + Intergenic
902617394 1:17631257-17631279 TTTTTTTCTGGGAGGGAGGGAGG - Intronic
902757807 1:18560647-18560669 TTTTTTTATGGGGGTGGTGGGGG - Intergenic
902827115 1:18983482-18983504 TTTTTGGGGGGGAGGGGTGGGGG - Intergenic
902868036 1:19293865-19293887 TTTTTTGGGGGGGGGGGTGGGGG + Intergenic
902969686 1:20038265-20038287 TTTTTTTTGGGGGGTGGTGGTGG - Intronic
903187522 1:21637156-21637178 TTTTTTTTGGTGGTGGTTGGGGG + Intronic
903272868 1:22202567-22202589 TTTTTTTTGGGGGGGGTAGTGGG + Intergenic
903990191 1:27262213-27262235 TTTTTTTAGGTCAGGCATGGTGG - Intronic
904113051 1:28141702-28141724 TTTTTTTGGGTGGGGGATGGTGG - Intergenic
904143946 1:28375319-28375341 TTTTTTTTTGGGGGGGTGGGTGG - Intronic
904191249 1:28745722-28745744 TTTTTTTTGGGGGGGGGGGGCGG - Intronic
904246127 1:29189379-29189401 TTTTTGTAGAGATGGGTTGGGGG + Intergenic
904639041 1:31908393-31908415 TTTTTGTGGGGGAGGGTTGGTGG - Exonic
904722041 1:32517474-32517496 TTTTTTTGGGGGGGTGGTGGGGG - Intronic
904856174 1:33499770-33499792 TTTTTTTGGGGGGGAGATGGGGG + Intergenic
905073395 1:35247705-35247727 TTTTTGTAGAGATGGGTTGGGGG + Intergenic
905398618 1:37685185-37685207 TTTTTTTTGGGGGGGGGGGGTGG + Intronic
905419329 1:37828975-37828997 TTTTGTTAGAGGAGAGTTGAAGG - Intronic
905562968 1:38941795-38941817 TTTTGTTTGGGGAGGGACGGAGG - Intronic
905768062 1:40619743-40619765 GTTTTTTAGGGGGTGGGTGGGGG + Intergenic
905893850 1:41532942-41532964 CTTTTTGAGGGCAGGGTTTGGGG - Intronic
906121836 1:43398434-43398456 TTTTGTTAAGGGATGGTTTGGGG - Intronic
906220154 1:44071984-44072006 TTTTTTTTGGGGGGGGACGGGGG + Intergenic
906262617 1:44405793-44405815 TTTTATTTGGGGAGGGGGGGAGG + Intronic
906371344 1:45256641-45256663 TTTTTTTTGGCGGGGGTGGGGGG + Intronic
906571395 1:46844647-46844669 TTTTTGTGGGGGTGGGCTGGAGG - Intergenic
906599875 1:47116595-47116617 TTTTTGTGGGGGTGGGCTGGAGG + Intronic
906621408 1:47283893-47283915 TTTTTTTTGCGGGGGGGTGGGGG + Intronic
906621409 1:47283894-47283916 TTTTTTTGCGGGGGGGTGGGGGG + Intronic
906932102 1:50180121-50180143 TTTTGGTGGGGGTGGGTTGGGGG - Intronic
907198312 1:52705066-52705088 TTTTTTTCGGGGGGGGGGGGGGG + Intergenic
907700518 1:56782758-56782780 GTTTCTTAGGGGAGGGTCTGTGG - Intronic
908005500 1:59723557-59723579 TTTTTTTGGGGGGGGGTGGTTGG + Intronic
908073790 1:60491948-60491970 CTCTTTTAGGGCAGGGATGGTGG - Intergenic
908534302 1:65064988-65065010 TTCCTTTGAGGGAGGGTTGGGGG - Intergenic
908606655 1:65804952-65804974 TTTTTTTTTGGGGGGGTGGGTGG + Intronic
908655964 1:66389206-66389228 GTGGTTTAAGGGAGGGTTGGGGG + Intergenic
908944099 1:69473489-69473511 ATTTTTTGGGTGGGGGTTGGGGG - Intergenic
909354753 1:74695888-74695910 TTTTTTGGGGGGGGGGGTGGGGG + Intergenic
909621355 1:77671001-77671023 TTTTTTTGGGGGGGTGGTGGGGG + Intronic
910058045 1:83055434-83055456 TTTTTTTAGGAGACAGTTGCAGG - Intergenic
910681621 1:89871446-89871468 TATTTTTAGGAGAGGGAAGGGGG - Intronic
910822707 1:91368563-91368585 CTCTTTTAGGGCAGGGCTGGTGG - Intronic
911184959 1:94894094-94894116 TTTTTTTGGGGGGGAGGTGGTGG - Intronic
911361773 1:96885502-96885524 TTTTTTTAGAGCAGTCTTGGAGG - Intergenic
911426376 1:97719152-97719174 TTTTTTTTTGGCAGGGTTGGGGG - Intronic
911454237 1:98103396-98103418 TTTTTTGAGGGGAGGGGAGTAGG + Intergenic
911650949 1:100387860-100387882 GTTTTTTTGGAGGGGGTTGGGGG - Intronic
912243574 1:107937938-107937960 TTTTTTGAGTTGAGGGTTGCTGG - Intronic
912276908 1:108268548-108268570 TTCTTGTAGGGGTGGGTGGGAGG + Intergenic
912291321 1:108425808-108425830 TTCTTGTAGGGGTGGGTGGGAGG - Intronic
912679838 1:111722082-111722104 TTATTTTAGGGGTTGGGTGGAGG + Exonic
912896605 1:113598217-113598239 TTTTTTTGGAGGGGGGGTGGGGG - Intronic
913013586 1:114710190-114710212 TATTTTTTGGGGGGGGTTGGGGG - Intronic
913420334 1:118660046-118660068 ATATTTTAGGGCAGGGTTGATGG + Intergenic
913448355 1:118973750-118973772 TGTGTGTAGGGGAGTGTTGGGGG - Intronic
913660997 1:121006427-121006449 TTATTTTATAGGAGGCTTGGAGG + Intergenic
914012364 1:143789592-143789614 TTATTTTATAGGAGGCTTGGAGG + Intergenic
914165468 1:145171592-145171614 TTATTTTATAGGAGGCTTGGAGG - Intergenic
914522538 1:148430898-148430920 TTTTTTTTGGCCAGGCTTGGTGG + Intergenic
914591137 1:149106902-149106924 TTTTGTCGGGGGGGGGTTGGTGG - Intergenic
914650993 1:149698201-149698223 TTATTTTATAGGAGGCTTGGAGG + Intergenic
914728512 1:150349876-150349898 TTTTTTTGGGGGCGGGGGGGCGG + Intronic
915321043 1:155056683-155056705 ATTTCTTAGAGGAGGGTAGGAGG + Intronic
915463473 1:156082672-156082694 TTTTTTAAGGGGAGGGTGCGGGG + Intronic
915968119 1:160330115-160330137 TTTTTTTTTGGGGGGGGTGGCGG - Intronic
916020220 1:160785009-160785031 CTCTTTTAGGGGAGGCCTGGTGG - Intergenic
916695749 1:167234442-167234464 GTATTTTAGGGTAGGTTTGGTGG + Intronic
916756303 1:167773382-167773404 TTTTTTTAGGGCAGGGGTGGAGG + Intronic
916949637 1:169766431-169766453 TTTTTTTGGGTGGGGGCTGGAGG - Intronic
917788089 1:178480847-178480869 TTTTTTTTGGTGGGGGGTGGTGG - Intergenic
917858205 1:179119534-179119556 TTTTTTTGGGGGGGTGTGGGGGG - Intronic
917858206 1:179119535-179119557 TTTTTTTTGGGGGGGTGTGGGGG - Intronic
917985880 1:180318161-180318183 TTTTTTTTGGGGGGGGGGGGCGG - Intronic
918022445 1:180708903-180708925 TTTTTTTGGGGGGGGGGGGGCGG + Intronic
918520696 1:185411914-185411936 TTTTTTGAGGGGCGGGCCGGGGG + Intergenic
918548224 1:185709382-185709404 CTCTTTTAGGGCAGGGCTGGTGG - Intergenic
918662438 1:187106288-187106310 TTTTTTGGGGGGGGGGTGGGGGG - Intergenic
918662439 1:187106289-187106311 TTTTTTTGGGGGGGGGGTGGGGG - Intergenic
918687725 1:187440177-187440199 TTTGTTTATGGAAGTGTTGGGGG + Intergenic
918826324 1:189329444-189329466 TTCTTTTAGGGCAGGCCTGGTGG + Intergenic
919074352 1:192795913-192795935 TTTTTTTTGGGGAAGATTGAAGG + Intergenic
919258824 1:195162645-195162667 TTTTTTTAGTGGGGGGAGGGCGG + Intergenic
919490007 1:198195110-198195132 TTTTTTTGGGGAAGGTTTAGTGG + Intronic
919549776 1:198970479-198970501 TTTTTTTAGTGGGGGGCTGGAGG + Intergenic
919609634 1:199729312-199729334 TTTTTTTGGTGGAGGTTTGAGGG - Intergenic
919702732 1:200648024-200648046 TTTTTTTGGGGGGGGGGAGGGGG + Intronic
920322499 1:205135326-205135348 TTTTTTTGGGGGGGGTTGGGGGG - Intergenic
920322500 1:205135327-205135349 TTTTTTTTGGGGGGGGTTGGGGG - Intergenic
920521072 1:206626956-206626978 CTTTTTTTGGGGGGGGGTGGGGG - Intergenic
920603336 1:207352238-207352260 TTTTTTTTGTGGGGGGTGGGGGG + Intronic
920763058 1:208804308-208804330 TTTTTTTTTGGGGGGGGTGGTGG + Intergenic
920763059 1:208804309-208804331 TTTTTTTTGGGGGGGGTGGTGGG + Intergenic
920784450 1:209027429-209027451 TTTTTGAAGGGGAAGGTGGGGGG + Intergenic
921083172 1:211760454-211760476 TCTTTTTTGAGGGGGGTTGGGGG - Intronic
921096602 1:211892121-211892143 TTTTTTTTGGTGGGGGGTGGAGG + Intergenic
921127026 1:212187173-212187195 TTTGTTTAGGGTGGGGGTGGTGG + Intergenic
921210544 1:212893058-212893080 TTTTTTTTGGGGGGGGGTGCCGG + Intronic
922197297 1:223370717-223370739 CTCTTTTAGGGCAGGCTTGGTGG + Intergenic
922289861 1:224201126-224201148 TTTTTTTGGGGGGCGGTGGGGGG - Intergenic
922637369 1:227187673-227187695 TTTTTTGGGGGGGGGGTGGGGGG - Intronic
922637370 1:227187674-227187696 TTTTTTTGGGGGGGGGGTGGGGG - Intronic
922964627 1:229678593-229678615 TTTTTTTGGGGGCGGGGTTGGGG + Intergenic
922964628 1:229678594-229678616 TTTTTTGGGGGCGGGGTTGGGGG + Intergenic
923041037 1:230319862-230319884 TTTTTTTTGTGGCGGGGTGGGGG + Intergenic
923204867 1:231749223-231749245 TTTTTTTTGGTGGGGGTAGGGGG + Intronic
923574336 1:235144179-235144201 TTTTTGTGGGGGAGGGTTGGTGG - Intronic
923731139 1:236551356-236551378 TATTATTAAGGGAGGGGTGGTGG - Exonic
923788515 1:237091421-237091443 TTTTTTTTGGGGGGGGCGGGGGG + Intronic
924005509 1:239606271-239606293 TTTTTTTTGGGGAGGGTGCGGGG + Intronic
924026813 1:239842219-239842241 TTTTTTTTTGAGGGGGTTGGGGG + Intronic
924122879 1:240820462-240820484 TTTTTTTAGGCAGGGGGTGGGGG + Intronic
924319958 1:242838980-242839002 TTTTTTTGGGGGGGGGATGGGGG - Intergenic
924374288 1:243389144-243389166 TTTTTTTGGGGGGGGGAGGGGGG - Intronic
924374289 1:243389145-243389167 TTTTTTTTGGGGGGGGGAGGGGG - Intronic
924418087 1:243880361-243880383 TTTTTTTTGGGGGGGGTTGGGGG + Intergenic
924526055 1:244850470-244850492 TTTTTTTTGGGGGGGGGTGTGGG - Intronic
924541064 1:244981190-244981212 TTTTTTTGGCGGTGGGGTGGTGG - Intronic
924715370 1:246567844-246567866 TTTTTTAAGGGGAGAGGGGGAGG - Intronic
924750148 1:246879826-246879848 TTTTTTTTTGGCGGGGTTGGGGG - Intronic
1063338287 10:5237946-5237968 TTTTTTTTTGGCGGGGTTGGGGG - Intergenic
1063501901 10:6563055-6563077 TTTTGTTGGGGGAGGGGAGGTGG - Intronic
1063851151 10:10192281-10192303 TTTTTTCTGGGTAGGGTTTGTGG - Intergenic
1063874694 10:10461835-10461857 CTTTTTTTGGGGATGGTGGGAGG - Intergenic
1063984363 10:11485767-11485789 TTTTTTGGGGGGTGGGTAGGTGG + Intronic
1064111153 10:12540100-12540122 TTTTTTTTTTGGAGAGTTGGGGG + Intronic
1064233301 10:13549012-13549034 TTTTTTTAGGGGGGTCCTGGGGG + Intergenic
1064916415 10:20463854-20463876 TTCTTTTAGGGCAGGCCTGGTGG + Intergenic
1064958680 10:20939399-20939421 CTCTTTTAGGGCAGGCTTGGTGG - Intronic
1065055112 10:21836291-21836313 TTCTTTTAGGGCAGGCCTGGTGG - Intronic
1065188333 10:23190199-23190221 TTTTTTTGGGGGGAGGGTGGGGG - Intergenic
1065248147 10:23780677-23780699 TTCTTTTTTGGGAGGGTGGGGGG + Intronic
1065358474 10:24866392-24866414 TTATTTGAGGGCAGGTTTGGGGG + Intronic
1065401464 10:25306954-25306976 TTTTTTAGGGAAAGGGTTGGGGG + Intronic
1065747996 10:28859306-28859328 TTTTTTTTGGGGGGGGTGGGGGG + Intronic
1065751908 10:28895399-28895421 TTTTTTTTGGGGGGGGCGGGGGG + Intergenic
1065761002 10:28983298-28983320 TTTTTTTTGGGGGGGGGGGGAGG + Intergenic
1066075333 10:31869568-31869590 TTTTTTTAGGGGGGAGGGGGTGG - Intronic
1066173742 10:32881092-32881114 TTACTTTTGGGGAGGGTTTGAGG + Intronic
1066178503 10:32936515-32936537 TTTTGTTGGGGGAGAGGTGGGGG - Intronic
1066319677 10:34289186-34289208 TTTTTTGAGGGGAGGGTGTTGGG + Intronic
1066692768 10:38047177-38047199 TTTTTTTTTGGCAGGGGTGGGGG - Intronic
1066728235 10:38412878-38412900 TTTTGGTAGGGAAGGGGTGGGGG + Intergenic
1067144987 10:43688394-43688416 TTTTTTTATGGGGGGGGGGGGGG + Intergenic
1067301333 10:45013346-45013368 TTCTTTTAGGGCAGGCCTGGTGG + Intergenic
1067339470 10:45389658-45389680 TTCTTTTAGGGCAGGCCTGGTGG - Intronic
1067390528 10:45858886-45858908 TTTTTTTTTGGGGGGGGTGGGGG + Intergenic
1067390529 10:45858887-45858909 TTTTTTTTGGGGGGGGTGGGGGG + Intergenic
1067418428 10:46125360-46125382 TTTTTTTTGGGGGGGGGGGGCGG - Intergenic
1067446576 10:46352701-46352723 TTTTTGGGGGGGAGGGTGGGTGG - Intergenic
1067872750 10:49977189-49977211 TTTTTTTTTGGGGGGGTAGGGGG - Intergenic
1068030200 10:51697513-51697535 TTTTTTTAATTGAGGGTGGGGGG - Exonic
1068530375 10:58179241-58179263 TTTGTGTGGGGGAGGGGTGGGGG + Intergenic
1068723150 10:60269643-60269665 TTTTTTTGGGGGGGGGGAGGGGG - Intronic
1068868460 10:61919037-61919059 TTTTTTTGGGGGGGGGGGGGGGG - Intronic
1069409750 10:68141065-68141087 TTTTTTTGGGGGGGTGGTGGAGG - Intronic
1069520593 10:69116869-69116891 TTTTTTGGGGGGGGGGTTGTGGG + Intergenic
1069732777 10:70629857-70629879 TTTTTTTTGGGGGGGGGAGGGGG + Intergenic
1069978193 10:72232547-72232569 TTTTTTGGGGGGTGGGGTGGGGG - Intronic
1070134522 10:73680585-73680607 TTTTTTTTGGGGGGGGTGGGTGG + Intronic
1070275749 10:75004868-75004890 TTTTTCAGGGGGAGGGGTGGGGG + Intronic
1070419150 10:76219079-76219101 TTCTTTTAGGGCAGGCCTGGTGG - Intronic
1070427373 10:76302524-76302546 TTTTTTTTGGGGGGTGGTGGTGG + Intronic
1070455496 10:76610462-76610484 CTCTTTTAGGGCAGGGCTGGTGG - Intergenic
1070533018 10:77353965-77353987 TTTTTTGGGGGGGGGGGTGGTGG + Intronic
1070620674 10:78008004-78008026 TTTTTTGGGGGGAGGGAGGGGGG + Intronic
1070930881 10:80259843-80259865 TCTTTTTGGGAGAGGGTTGTGGG - Intergenic
1070956155 10:80464855-80464877 TTTTTTGGGGGAAGGGTGGGAGG + Intronic
1071248451 10:83790925-83790947 TTTTTTTGGCGGGGGGTGGGGGG + Intergenic
1071423005 10:85520074-85520096 TTTTTTGGGGGGGGGGTTGGAGG + Intergenic
1071789446 10:88938730-88938752 TTTTTTTTGGGTGGGGGTGGGGG + Intronic
1071904441 10:90157629-90157651 TTCTTTTAGGGCAGGCCTGGTGG + Intergenic
1072041903 10:91614591-91614613 TTTTTTTGGGGGTGGGGTGGGGG - Intergenic
1072228325 10:93390708-93390730 TTGTTTTAGTGGAGGGATGTTGG + Intronic
1072958102 10:99904629-99904651 AATTTTTAGAGGAGGGATGGTGG - Intronic
1072999024 10:100272052-100272074 TTTTTTTGGGGGAGGGGGAGGGG + Intergenic
1073037657 10:100575401-100575423 GTTTTTTTGTGGGGGGTTGGTGG - Intergenic
1073083169 10:100872496-100872518 TCTTACTAGGGGAGGGTTAGGGG - Intergenic
1073325719 10:102643310-102643332 TTTTCCAAGGGGAGGGCTGGCGG - Intergenic
1073345778 10:102781862-102781884 TTTTTTTTGGGGGGGGTGGGGGG + Intronic
1073419220 10:103410786-103410808 TTTTTTTAGGCCAGGTGTGGTGG + Intronic
1073449438 10:103600922-103600944 TTATTTTAGGGGTTGTTTGGGGG - Exonic
1073520580 10:104125088-104125110 TTTTTTTAGGCTGGGGATGGTGG - Intronic
1073826698 10:107331928-107331950 TTTTTTTAGGCCAGGCGTGGTGG - Intergenic
1074034781 10:109727564-109727586 ATTTTTGAGGGGGAGGTTGGTGG + Intergenic
1074168229 10:110905563-110905585 TTTTTTTTTTGGAGGGGTGGGGG - Intronic
1074332866 10:112536747-112536769 TTTTTTGGGGGGAAGGGTGGGGG - Intronic
1074550472 10:114437772-114437794 ATTGCTTAGGGGAGAGTTGGGGG + Intronic
1074706952 10:116141579-116141601 TTTTTTGAGGGGGTGGTGGGCGG + Intronic
1074718493 10:116243477-116243499 TTTTTGGGGGGCAGGGTTGGGGG - Intronic
1075183969 10:120238480-120238502 TTCTTTTAGGGCAGGCCTGGTGG + Intergenic
1075389482 10:122082555-122082577 CTTTTGTGGGGGTGGGTTGGGGG + Intronic
1075454357 10:122575516-122575538 TTTTTTTTGGGGGGGTGTGGTGG + Intronic
1076012914 10:127004770-127004792 TTTTTTTTGGGGCGGGGGGGTGG - Intronic
1076469398 10:130708145-130708167 CTTTCTTATGGGAGGGGTGGGGG + Intergenic
1077031916 11:472193-472215 TCTTTTCTGGGGAGGGTAGGGGG + Intronic
1077240832 11:1509634-1509656 CTTTTTTTGGGGAGGGGTGATGG - Intergenic
1077412074 11:2408291-2408313 TTTTTTCGGAGGAGGGGTGGAGG - Intronic
1077558126 11:3236942-3236964 TTTTTTTAGAGCAGGGTGGGGGG + Intergenic
1077625691 11:3769423-3769445 GTTTTTTTGGTGGGGGTTGGAGG - Intronic
1077912485 11:6585556-6585578 TTTTTTTTGGAGGGGGTTGGGGG - Intronic
1078287704 11:9974641-9974663 TTTTTTTTGGGCGGTGTTGGGGG - Intronic
1078390868 11:10934296-10934318 TTTTTGTAGGCGAGGGTAAGGGG + Intergenic
1078599759 11:12719569-12719591 TTTTTTGGGGGGAGGGGGGGCGG + Intronic
1078660875 11:13284615-13284637 TTTTTTTTGGCGGGGGGTGGGGG + Intronic
1078970829 11:16409274-16409296 TTTTTTTGGAGGGGGGTTAGGGG - Intronic
1079045633 11:17100237-17100259 TTTTTTTGGGGGCGGGGGGGGGG + Intronic
1079137148 11:17781954-17781976 TTTTATTTGGGGAGGGGGGGTGG + Exonic
1079681373 11:23302343-23302365 TTCTTTTAGGGTAGGCCTGGTGG + Intergenic
1079802019 11:24880476-24880498 TTTGTTAGGGGGACGGTTGGTGG + Intronic
1079810524 11:24993857-24993879 TTTTTTTTGGGGGGGGTGTGGGG + Intronic
1079810525 11:24993858-24993880 TTTTTTTGGGGGGGGTGTGGGGG + Intronic
1080690292 11:34551328-34551350 TTCTTTTAGGGTAGGCCTGGTGG + Intergenic
1080728165 11:34917521-34917543 TTATTTTGGGAGAAGGTTGGAGG + Intronic
1080731370 11:34958289-34958311 TTTTTTTAGGGGGGGGCGTGCGG + Intronic
1080736061 11:35014855-35014877 TTTTTTTAGTGGGGCTTTGGTGG + Intronic
1081345174 11:41976660-41976682 TTTATTCAGGGGAAGATTGGAGG + Intergenic
1081468748 11:43350267-43350289 CTCTTTTAGGGCAGGCTTGGTGG + Intergenic
1082020398 11:47528102-47528124 TTTGTTTTTGGGAGGGGTGGGGG - Intronic
1082043549 11:47706750-47706772 TTTTTTTAAGACAGGGTTGCTGG + Intronic
1082602163 11:55171706-55171728 TTCTTTTAGGGCAGGCCTGGTGG + Intergenic
1082889636 11:58125234-58125256 TTTTTTTGGGGGGGGGGCGGTGG - Intronic
1082970681 11:59017192-59017214 CTTTTTTAGGGCAGGCCTGGTGG - Intronic
1083134857 11:60662731-60662753 TTTTTTTACTCGAGGATTGGTGG + Intergenic
1083452777 11:62757195-62757217 TTGTTTTACAGGGGGGTTGGGGG + Intergenic
1083538762 11:63496023-63496045 TTTTTTTGTGGGGGGATTGGGGG + Intergenic
1083636128 11:64121955-64121977 TTTTTTTAGGGGAGATTTAAAGG - Intronic
1083647713 11:64182473-64182495 CTTTTTTTGGGGGGGGGTGGGGG - Intergenic
1083825244 11:65198826-65198848 ATTTTTTTTGGGAGGGTTGGGGG + Intronic
1083836815 11:65274978-65275000 TTTTTCTAGGCCAGGGGTGGTGG - Intronic
1084240068 11:67813247-67813269 CATTTTTAGGGGAAGGGTGGGGG + Intergenic
1084264701 11:67998893-67998915 TTTTTTTTGGTGGGGGTTGGGGG - Intronic
1084266092 11:68005891-68005913 TTTTTGTAGAGATGGGTTGGGGG - Intergenic
1084480390 11:69416446-69416468 TCTTTTTTGGGGAGGGTGGTCGG - Intergenic
1084506339 11:69570673-69570695 TTTTTTGAGTGGGCGGTTGGTGG - Intergenic
1084778297 11:71391844-71391866 TATGTTTGGGGGAGGGTGGGGGG + Intergenic
1084832379 11:71779595-71779617 CATTTTTAGGGGAAGGGTGGGGG - Intergenic
1085074808 11:73581635-73581657 TTTTTTTAGGGAAGAGTTCTTGG - Intronic
1085167508 11:74416415-74416437 TTTTTAGGGGGGAGGGTGGGGGG + Intergenic
1085437040 11:76515200-76515222 TTTTTTTGGGGGGGGGGAGGAGG + Intronic
1085492250 11:76931642-76931664 CTCTTTTAGGGCAGGGCTGGTGG + Intronic
1085495582 11:76965773-76965795 CTCTTTTAGGGCAGGGCTGGTGG - Intronic
1085567156 11:77524569-77524591 TCTGTGTAGGGGAGGGTTGGAGG + Intronic
1086101644 11:83106468-83106490 TTTTTTTTCAGGTGGGTTGGGGG + Intergenic
1086301161 11:85427591-85427613 CTCTTTTAGGGCAGGGCTGGTGG - Intronic
1086417170 11:86599913-86599935 CTCTTTTAGGGCAGGCTTGGTGG - Intronic
1086440878 11:86828671-86828693 CTCTTTTAGGGCAGGCTTGGTGG + Intronic
1086453500 11:86939772-86939794 TTTTTAAAGGGGTGGGTGGGGGG + Intronic
1086529488 11:87767597-87767619 TTTTTTTTTGGTTGGGTTGGGGG - Intergenic
1086661800 11:89428184-89428206 CTCTTTTAGGGGAGGCCTGGTGG - Intronic
1086762960 11:90656596-90656618 TATTTTTTGGCGGGGGTTGGGGG + Intergenic
1087267518 11:96076977-96076999 ATTTTGTGGGGAAGGGTTGGAGG - Intronic
1087280916 11:96209221-96209243 TTTTTTTGGGTGGGGGGTGGGGG + Intronic
1087341225 11:96910059-96910081 TTCTTTTAGGGCAGGCCTGGTGG + Intergenic
1087518862 11:99203584-99203606 TTTTTTTGGGTGGGGGGTGGTGG + Intronic
1087612758 11:100453682-100453704 CTCTTTTAGGGCAGGCTTGGTGG - Intergenic
1087737863 11:101854441-101854463 CTTTTTTAGGGCAGGCCTGGTGG - Intronic
1088152687 11:106764964-106764986 TTTTTTTGGGGGGGGGTTGGGGG + Intronic
1088263158 11:107964288-107964310 TTTTTTTTGGCGGGGGTGGGGGG + Intergenic
1088391738 11:109321826-109321848 TTTTTTTATGGGCGGGGTGGGGG + Intergenic
1089177551 11:116559469-116559491 TTTTTTGGGGGGGGGGTGGGCGG - Intergenic
1089475370 11:118756014-118756036 TTTTTTTGGGGGGGGGGGGGAGG - Intronic
1089551177 11:119279477-119279499 TTTTTTTAGGGGGGGGCATGGGG - Intronic
1089586143 11:119511037-119511059 TATTTTTGGGGGTGGGATGGAGG + Intergenic
1089760000 11:120716241-120716263 TTTTTTGGGGGGTGGGTGGGCGG + Intronic
1089870961 11:121672477-121672499 TTTTTGTATGGGAGAGTGGGTGG - Intergenic
1090159966 11:124482195-124482217 TTTTTGTGGGGGTGGGGTGGGGG + Intergenic
1090958074 11:131531307-131531329 TTTTTTTGGGGGGGAGGTGGGGG + Intronic
1091039008 11:132259392-132259414 GTTTTTTAGGCCAGGCTTGGTGG + Intronic
1091052481 11:132385366-132385388 CTCTTTTAGGGCAGGGCTGGTGG - Intergenic
1091062915 11:132480834-132480856 CTCTTTTAGGGCAGGGCTGGTGG - Intronic
1091483619 12:860932-860954 TTTTTTTTGGCGGGGGGTGGTGG + Intronic
1091524496 12:1284665-1284687 TTTTTTTAGGAGTGGTTTGAGGG + Intronic
1091981018 12:4864062-4864084 TTTTCTTCGGGGAGAGTTGAGGG - Intergenic
1091988197 12:4931399-4931421 TTTTTTTTGGTGGGGGTGGGGGG - Intergenic
1091997594 12:5006632-5006654 TTTCTTTTGGGGGGGGTTGTGGG - Intergenic
1092068117 12:5609339-5609361 TTTTCTTTGGGGAGGATTGGCGG - Intronic
1092125615 12:6073204-6073226 TCTTTTCAGGGGAGGCTTGGTGG - Intronic
1092140880 12:6182634-6182656 TCCTTATAGGGGAGGTTTGGAGG - Intergenic
1092185118 12:6473114-6473136 TTTTTTCAGGGGAAAGTTGGTGG - Intergenic
1092259497 12:6945358-6945380 TTTTGTTTGGGGGGGGTTGGTGG + Intronic
1092462613 12:8698946-8698968 TTTTTTTGGGGGGGGGTGAGGGG - Intronic
1092462614 12:8698947-8698969 TTTTTTTTGGGGGGGGGTGAGGG - Intronic
1092575372 12:9776735-9776757 TTTTTTTATGGGGGGGGCGGTGG + Intergenic
1092603057 12:10087808-10087830 TTTTTTTAGGCCAGGAATGGTGG - Intronic
1092696267 12:11175176-11175198 TTATTTTATTAGAGGGTTGGTGG + Intergenic
1093332268 12:17857369-17857391 CTCTTTTAGGGGAGGCCTGGTGG - Intergenic
1093782036 12:23147795-23147817 CTTTTTTAGGGCAGGCTAGGTGG - Intergenic
1093836578 12:23838836-23838858 TTTTTTTTGGGGGGGGGGGGCGG + Intronic
1094452677 12:30598959-30598981 CTTTTTTAGAAGAGGGTTGTAGG + Intergenic
1094559720 12:31540656-31540678 TTTTTTGGTGGGGGGGTTGGGGG - Intronic
1094564185 12:31584830-31584852 TTTTTTTCGGGGAGGGTGGGTGG - Intronic
1094779556 12:33774815-33774837 CTCTTTTAGGGCAGGGCTGGTGG - Intergenic
1094792667 12:33932384-33932406 CTCTTTTAGGGGAGGCCTGGTGG - Intergenic
1094858567 12:34432951-34432973 CTCTTTTAGGGCAGGGCTGGTGG - Intergenic
1095430676 12:42130977-42130999 TTTTTTTGGGGCAGGGAGGGTGG - Intronic
1095553530 12:43472801-43472823 CTCTTTTAGGGCAGGCTTGGTGG - Intronic
1095852632 12:46827653-46827675 TTTTATGAGGGGAGAGGTGGAGG - Intronic
1095861741 12:46924962-46924984 AATTTTGGGGGGAGGGTTGGTGG - Intergenic
1096788240 12:54030008-54030030 TGTGATTAGGGGAGAGTTGGTGG - Exonic
1096851796 12:54444009-54444031 TTTTTGTGGGGGTGGTTTGGGGG + Intergenic
1096872648 12:54603481-54603503 TTTTTTTAATGGGGGTTTGGGGG + Intergenic
1097120234 12:56725932-56725954 TTTTTTTGGGGGGGGGGCGGGGG - Intronic
1097272618 12:57786620-57786642 GTATTTTAGAGGAGGTTTGGGGG + Intronic
1097684972 12:62682817-62682839 TTTTTCATGGGGAGGGGTGGTGG + Intronic
1097815753 12:64071865-64071887 TTTTTTTTGGGGGGGGGTGAGGG - Intronic
1097850423 12:64405065-64405087 TTCCTTTAGGGGAGGGATCGGGG + Intronic
1098057500 12:66523494-66523516 TTCTTTTAGGGCAGGCCTGGTGG - Intronic
1098091594 12:66907852-66907874 TTATTTGAGGGGAGGGTGGCTGG + Intergenic
1098464134 12:70766979-70767001 TTCTTTTAGGGCAGGCCTGGTGG - Intronic
1098737535 12:74125730-74125752 TTTTTTTTTGGGAGGGTGGTGGG - Intergenic
1099201165 12:79678877-79678899 TTTTTTTTGGCGGGGGTGGGAGG + Intronic
1099441439 12:82704071-82704093 TTTTTTTATGGGAGGTGGGGAGG + Intronic
1099538334 12:83872911-83872933 CTCTTTTAGGGCAGGCTTGGTGG - Intergenic
1099705134 12:86142723-86142745 TTTTTTTTGTGGAGGGTTGGGGG + Intronic
1099926623 12:89026714-89026736 TTTTTTTTGGGGGGGGGTTGGGG + Intergenic
1099926624 12:89026715-89026737 TTTTTTTGGGGGGGGGTTGGGGG + Intergenic
1100313561 12:93421199-93421221 TTTTTTTTTGGGGGGGCTGGGGG + Intronic
1100313562 12:93421200-93421222 TTTTTTTTGGGGGGGCTGGGGGG + Intronic
1100321430 12:93496801-93496823 TTTTTTTTGGGGGGGTTTGGGGG + Intronic
1100877777 12:98981016-98981038 TTTTTTTAGGCCAGGCATGGTGG + Intronic
1100973607 12:100098217-100098239 CTTTTTTTGGGGAGGGTGCGGGG - Intronic
1101731597 12:107431620-107431642 TTTTTTTGGGGGCGGGTGCGGGG - Intronic
1102228362 12:111245361-111245383 TTTTTTTTGGGTAGAGATGGGGG - Intronic
1102250215 12:111381543-111381565 TTTTTTTGGTGGGGGGTTGCGGG + Intergenic
1102252681 12:111398001-111398023 TTTTTTTGGGGGGGGGTTGGGGG - Intergenic
1102252682 12:111398002-111398024 TTTTTTTTGGGGGGGGGTTGGGG - Intergenic
1102292999 12:111716201-111716223 TTTTTTTGGGGGGGGATGGGGGG - Intronic
1102293000 12:111716202-111716224 TTTTTTTTGGGGGGGGATGGGGG - Intronic
1102411756 12:112726095-112726117 TTTTTTTTCGGGGGGGTGGGGGG + Intronic
1102546120 12:113657033-113657055 TTTTTTTTGCGGGGGGTGGGGGG + Intergenic
1102872981 12:116428303-116428325 TTTTTTTTGGTGGGGGTGGGGGG - Intergenic
1102908561 12:116695667-116695689 TTTTTTTGGGGGGGGGGTGGTGG + Intergenic
1102933247 12:116878357-116878379 TTCTTTTAGGGTAGGGAAGGTGG + Intronic
1103099765 12:118163440-118163462 TTTTTTTTTGGGGGGGGTGGGGG + Intronic
1103743656 12:123107744-123107766 ATTTTCTAGGGGAGGGTTTTGGG + Intronic
1104104025 12:125642001-125642023 TTTTTTCTGAGCAGGGTTGGGGG + Intronic
1104335262 12:127888614-127888636 TTTCTTTTGGGGAGGCTTGGGGG + Intergenic
1104390115 12:128384812-128384834 ATCTTTGAAGGGAGGGTTGGTGG - Intronic
1105070556 12:133231947-133231969 TGTGTTTTGGGGAGGGTTGAAGG - Intronic
1105312983 13:19229813-19229835 TTTTTTGGGGGGCGGGGTGGGGG + Intergenic
1105560331 13:21484577-21484599 TTTTTTTGGGGGAGGTGGGGTGG + Intergenic
1105843582 13:24275931-24275953 ATTTTTTGGGGGAGGGGTGAGGG - Intronic
1105852054 13:24343801-24343823 CTCTTTTAGGGCAGGGCTGGTGG - Intergenic
1106013129 13:25843919-25843941 TTTTCTCAGGGCAGGGTTGGAGG + Intronic
1106077156 13:26470503-26470525 TACTTTTAGGGGAGGGAAGGAGG - Intergenic
1106747192 13:32717897-32717919 TTTTTTTTTGGGGGGGTGGGTGG - Intronic
1106899622 13:34341384-34341406 TTCTCTTAGGGGTGGGTGGGGGG - Intergenic
1107084693 13:36413941-36413963 TTTTTTTGGGGGGGGGTTCGTGG - Intergenic
1107186070 13:37522619-37522641 TGTCTTCTGGGGAGGGTTGGGGG - Intergenic
1107274153 13:38657765-38657787 TTTTTTTGGGGGAGAGGGGGCGG + Intergenic
1107304599 13:39005027-39005049 CTGTTTTAGGGCAGGCTTGGTGG + Intergenic
1107384792 13:39896269-39896291 TTTCTTTTTGGGGGGGTTGGAGG + Intergenic
1107895109 13:44954337-44954359 TTTTTTTAGGGGGGGATGGTGGG - Intronic
1108300031 13:49064396-49064418 TTTTTTTGGGGGGGGGGCGGGGG - Intronic
1108508776 13:51136287-51136309 TTATTTTGGGGGTGGGTTGGGGG - Intergenic
1108536264 13:51383087-51383109 TTTTTTTTGCGGGGGGGTGGGGG - Intronic
1108643428 13:52404496-52404518 TTTTTTTTGGGTGGGGGTGGCGG - Intronic
1109239758 13:59871190-59871212 TTTTTTGGGGGGGGGGGTGGCGG + Intronic
1109405917 13:61900264-61900286 TTTTTATAGGGGAGGGGTTGGGG - Intergenic
1110057528 13:70993392-70993414 TTTTTTCTGGGGAGGTGTGGAGG + Intergenic
1110226885 13:73129088-73129110 TTTTTTTTGGTGGGGGGTGGTGG - Intergenic
1110721827 13:78770094-78770116 TTTTTTTTGGCGGGGGATGGTGG - Intergenic
1110986505 13:81977163-81977185 TTTTTGTGGGGGAGAGTTGGGGG - Intergenic
1111146908 13:84194398-84194420 TTTTTTTAAGGCAGGGATTGGGG + Intergenic
1111624609 13:90768713-90768735 TTTTTTTTGGGGCGGGGGGGCGG - Intergenic
1111660144 13:91199570-91199592 TTTATTTAGGCCAGGGGTGGTGG - Intergenic
1111691160 13:91564987-91565009 TTTTTTTGGGGGGGGGTCGGTGG + Intronic
1111920807 13:94409451-94409473 TTTTTTTTGCGGGGGGTGGGTGG + Intergenic
1112017035 13:95339955-95339977 TTTTTTTTGGGGGGGGGAGGCGG + Intergenic
1112035710 13:95494911-95494933 TTTTTTAAGAGTAGGGGTGGAGG - Intronic
1112140798 13:96639696-96639718 TATTTTTGGGGGAGGGTAGAAGG - Intronic
1112398202 13:99052587-99052609 TTTTTTTTGGGGAGGTTTGTGGG + Intronic
1112436209 13:99392982-99393004 TTTTTTCAGGGGAGAGGAGGTGG - Intergenic
1112469414 13:99674046-99674068 TTTTGTTGGGGTAGGGGTGGAGG + Intronic
1112985698 13:105446633-105446655 CTTTTTTAGGGGTGTGTGGGGGG + Intergenic
1113490356 13:110686874-110686896 TTTGTGCAGGGGAGGGTGGGTGG + Intronic
1113729423 13:112629386-112629408 TCTTTTTGGGGGAGGGGAGGAGG - Intergenic
1114003629 14:18288014-18288036 CTCTTTTAGGGCAGGGCTGGTGG + Intergenic
1114179293 14:20351839-20351861 TTTTTTTGGGGGAGAGTCAGGGG - Intronic
1114490229 14:23095759-23095781 CTTTTTTTGGGGAGGGGCGGGGG + Intronic
1114569043 14:23653077-23653099 GTTTTGTAGTTGAGGGTTGGAGG - Intergenic
1114642226 14:24231478-24231500 TTTTTTGAGGGGGGCGTGGGGGG + Intronic
1114751386 14:25208713-25208735 CTTTTTTAGGGCAGGCCTGGTGG + Intergenic
1115084806 14:29501538-29501560 TTTTTTTAGGGGAGTGTCAAGGG - Intergenic
1115170700 14:30502831-30502853 TTTTTTGAGGCAGGGGTTGGGGG - Intergenic
1115429551 14:33300719-33300741 CTTTTGTAGGGGAGGGGTTGGGG + Intronic
1115435281 14:33364997-33365019 TTTTTTTGGGGGAGGGGGGAGGG + Intronic
1115572216 14:34677345-34677367 TTTTTGTAGGGGCTGGATGGTGG + Intergenic
1115763364 14:36597786-36597808 TTTTTTTTGGGGGGGGAGGGGGG + Intergenic
1116168314 14:41363467-41363489 GTTTTTTTGGCGGGGGTTGGGGG + Intergenic
1116652658 14:47613519-47613541 TTTATTTCTGGGATGGTTGGTGG - Intronic
1116767186 14:49086998-49087020 TTCTTTTGGGAGAGGGTAGGTGG - Intergenic
1117387730 14:55232780-55232802 TTTTTTTTGCAGGGGGTTGGGGG + Intergenic
1117466307 14:55998242-55998264 TCTTTTTAGGGCAGGCCTGGTGG + Intergenic
1117468433 14:56018193-56018215 TCTTTTTAGGGCAGGCCTGGTGG + Intergenic
1117588468 14:57239757-57239779 TTTTTTTAGGGAAGGGACTGTGG - Intronic
1117667144 14:58068231-58068253 CTTTTTTGGAGGGGGGTTGGGGG - Intronic
1118749374 14:68795312-68795334 TCTTTTTTGGGGGGGGTGGGGGG - Intronic
1118842770 14:69525470-69525492 TTTTTTTGGAGGTGGGGTGGGGG + Intronic
1119026860 14:71159715-71159737 TTTTTTTAGGTCAGGCATGGTGG - Intergenic
1119078060 14:71664281-71664303 TTTTATTAGGGGTGGTTTGGTGG + Intronic
1119691558 14:76676792-76676814 TTTTTTTGGGGGGGAGTGGGTGG - Intergenic
1119856488 14:77904828-77904850 TTTGTTTGGGGGTGGGATGGGGG + Intronic
1119992394 14:79213618-79213640 TTTTTTTTGGGGGGGGGTGGCGG + Intronic
1119992395 14:79213619-79213641 TTTTTTTGGGGGGGGGTGGCGGG + Intronic
1121074728 14:91059160-91059182 TTTTTGTGGGGGCGGGGTGGGGG - Intronic
1121123629 14:91392281-91392303 TTTTGTTTTGGCAGGGTTGGGGG - Intronic
1121385312 14:93516445-93516467 TTTTTTGGGGGGGGGGGTGGGGG + Intronic
1121424723 14:93841677-93841699 TTTTTTTGGGGGGGGGTGAGAGG - Intergenic
1121622011 14:95356748-95356770 AGTTTTCAGGGGAGGGCTGGTGG - Intergenic
1122068762 14:99191705-99191727 TTTTTTTGGTGGAGGGCTGCGGG - Intronic
1122589505 14:102837143-102837165 TTTTTTTTGGGGGGGGGTGAAGG + Intronic
1123809840 15:23912645-23912667 TTTTTTTAGGTGGGGGTGGGTGG + Intergenic
1123949989 15:25262072-25262094 TTTTTTTTGGGGGGGGTGGAGGG - Intergenic
1123949990 15:25262073-25262095 TTTTTTTTTGGGGGGGGTGGAGG - Intergenic
1123956810 15:25344980-25345002 TTTTTGTAGGGGAGGTTGGGAGG - Intronic
1124056341 15:26243936-26243958 TTTTTTTTGCGGGGGGTGGGGGG + Intergenic
1124257692 15:28158913-28158935 TTCTTTTAGGGCAGGCCTGGTGG + Intronic
1124531395 15:30510840-30510862 TCTTGTTGGGGGAGGGTGGGAGG - Intergenic
1124767260 15:32496856-32496878 TCTTGTTGGGGGAGGGTGGGAGG + Intergenic
1124912789 15:33938836-33938858 TTTTTTTTGTGGGGGATTGGCGG + Intronic
1125013355 15:34905089-34905111 TCTTTTTTGGGGGGGGTGGGGGG + Intronic
1125176125 15:36823801-36823823 TTTTTTTAGGGGATGGGGGTTGG + Intergenic
1125352764 15:38784577-38784599 TTCTTTTAGGGCAGGCCTGGTGG - Intergenic
1125873966 15:43127625-43127647 TTTTTTTGGGCGAGGGGGGGTGG - Intronic
1125882249 15:43204959-43204981 TTTTTTTGGGGGGGGGGCGGAGG - Intronic
1125978412 15:43977145-43977167 TTTCTATAGGGGAGGGGTTGGGG + Intronic
1126016582 15:44357164-44357186 TTTTTTTGGGGGGCGGGTGGTGG - Intronic
1126444761 15:48729989-48730011 TTTTTTTTGGGGGGGGCCGGTGG - Intronic
1126468871 15:48985806-48985828 TTTTAGTGGGGGATGGTTGGGGG + Intergenic
1126477809 15:49084480-49084502 TTTTTCTGGGGGAGGGCTGGAGG - Intergenic
1127304780 15:57694654-57694676 TTTTTATGGGGCAGGGTTTGTGG - Intronic
1127498962 15:59538437-59538459 TTTTTTTTGCGGGGGGTGGGGGG - Intergenic
1127582521 15:60350650-60350672 TTCGTTTAGGGAAGGGTTGTGGG + Intronic
1127603482 15:60562414-60562436 TTTTTTTGAGGCGGGGTTGGGGG + Intronic
1127670228 15:61187941-61187963 GTGTGTTAGGGGAGGGTTGAGGG - Intronic
1128149991 15:65356679-65356701 TTTTTAAAGGCGAGGGTTGGGGG + Intronic
1128194621 15:65740953-65740975 TTTTTTTTGGGGGGGGTACGGGG - Intronic
1128574200 15:68759120-68759142 TTTTTTTGGGGAGGGGGTGGTGG - Intergenic
1128880359 15:71236864-71236886 TCTTTGAAGGAGAGGGTTGGAGG + Intronic
1129046983 15:72744412-72744434 TTTTTCTGGGGGAGGGGAGGGGG + Intergenic
1129161779 15:73751810-73751832 TTCTTTGTGGGGAGGGGTGGTGG + Intronic
1129354351 15:74979409-74979431 TTTTTTTGGGGGGGCGGTGGGGG - Intronic
1129485773 15:75870737-75870759 TTTCTTTTGAGGAGGGTTGATGG + Intronic
1129635419 15:77311672-77311694 TTTTTTTTTGTGGGGGTTGGGGG - Intronic
1129822807 15:78616354-78616376 TTTTTTTTTGGGGGGGTGGGGGG - Intronic
1130247844 15:82269575-82269597 TTTTTTTGGTGGAGGGTGGAGGG + Intronic
1130277020 15:82485591-82485613 TTTTTTTTGGTGGGGGTGGGGGG - Intergenic
1130469384 15:84212942-84212964 TTTTTTTTGGTGGGGGTGGGGGG - Intergenic
1130471635 15:84231181-84231203 TTTTTTGGGGGGGGGGTTGTGGG - Intergenic
1130471636 15:84231182-84231204 TTTTTTTGGGGGGGGGGTTGTGG - Intergenic
1130476874 15:84327506-84327528 TTTTTTTTGGTGGGGGTGGGGGG - Intergenic
1130479129 15:84345752-84345774 TTTTTTGGGGGGGGGGTTGTGGG - Intergenic
1130479130 15:84345753-84345775 TTTTTTTGGGGGGGGGGTTGTGG - Intergenic
1130494891 15:84460624-84460646 TTTTTTTTGGTGGGGGTGGGGGG + Intergenic
1130591678 15:85217571-85217593 TTTTTTTTGGTGGGGGTGGGGGG - Intergenic
1130593931 15:85235809-85235831 TTTTTGGAGGGGGGGGTTGTGGG - Intergenic
1131502168 15:92979073-92979095 TCTTTTTTTGGGGGGGTTGGGGG + Intronic
1131584379 15:93677228-93677250 CTCTTTTAGGGCAGGCTTGGTGG - Intergenic
1131608053 15:93930157-93930179 TTTTTTTAATGGTGGGTGGGTGG - Intergenic
1132094196 15:98969932-98969954 TTTTGTGGGGGGAGGGTTGGAGG + Intronic
1132254861 15:100367096-100367118 TTTTTTTAGGGTAGGCCTGGTGG - Intergenic
1132358345 15:101190253-101190275 TTTTTCTGGGGAAGGGTGGGTGG + Intronic
1132541613 16:512232-512254 TTTTTTTGGGTGGGGGTGGGTGG + Intronic
1132568979 16:635842-635864 ATTTCTTAGGGGAGGCTGGGGGG + Intronic
1132837872 16:1963605-1963627 TTTTTTTTGGGCGGGGTGGGCGG - Intronic
1133135202 16:3706279-3706301 TTTGTTTTGGGGTGGGGTGGGGG + Intronic
1133138263 16:3727491-3727513 TTTTTTTGGCGGGGGGGTGGGGG - Exonic
1133291381 16:4723877-4723899 TTTTTTTTTGGTAGAGTTGGGGG - Intronic
1133426921 16:5700296-5700318 TTTTTTTTGGCAAGGGTTAGTGG + Intergenic
1133463551 16:6008203-6008225 TTTTTTGGGGGGTGGGTGGGGGG - Intergenic
1133463552 16:6008204-6008226 TTTTTTTGGGGGGTGGGTGGGGG - Intergenic
1133528003 16:6625143-6625165 TTTTTTTTAGATAGGGTTGGTGG - Intronic
1133572388 16:7054206-7054228 TTTTTTTCGGGGGGGGGGGGCGG + Intronic
1133705769 16:8353327-8353349 TTTTTTTTGGTGGTGGTTGGGGG - Intergenic
1133893398 16:9902953-9902975 TTTTTTTGGCGGGGGGGTGGGGG + Intronic
1133914708 16:10098927-10098949 TTTTTTTGGGGGGGGGAGGGGGG - Intronic
1133914709 16:10098928-10098950 TTTTTTTTGGGGGGGGGAGGGGG - Intronic
1134164416 16:11918533-11918555 TTTTCTTAGGGGTGGGTGGGTGG - Intergenic
1134176973 16:12014972-12014994 TTTTTTTGGGGGAGAGGGGGAGG + Intronic
1134203712 16:12220297-12220319 TTTCTTTATGGGAGGGAGGGAGG + Intronic
1134243906 16:12525693-12525715 TTTTTTGGGGGGGGGGGTGGGGG - Intronic
1134336241 16:13302336-13302358 TATTTATAGGGGAGGCTTTGAGG - Intergenic
1134439303 16:14288245-14288267 TTTTTTTTTGGGGGGGTGGGCGG + Intergenic
1134778149 16:16871044-16871066 TTTTTTTTGGGGGGGGGGGGCGG - Intergenic
1135169502 16:20170824-20170846 GTTTTTAAGTGGAGGGTAGGAGG + Intergenic
1135346531 16:21693480-21693502 TTTTATTGTGGGAGTGTTGGTGG + Intronic
1135594482 16:23731207-23731229 TTGTTCTAGGGGAGAGGTGGAGG - Intergenic
1136415564 16:30101275-30101297 TTTTTTTGGGGGGTGGGTGGAGG - Intergenic
1136457815 16:30391832-30391854 TTTTTTTGGCGGGGGGGTGGGGG + Intronic
1136926858 16:34382123-34382145 TTTTTTTTGGTGGGGGGTGGGGG + Intergenic
1136926859 16:34382124-34382146 TTTTTTTGGTGGGGGGTGGGGGG + Intergenic
1136977715 16:35029683-35029705 TTTTTTTGGTGGGGGGTGGGGGG - Intergenic
1136977716 16:35029684-35029706 TTTTTTTTGGTGGGGGGTGGGGG - Intergenic
1137364942 16:47852501-47852523 TTTTTGGGGGGGGGGGTTGGGGG - Intergenic
1137423242 16:48354071-48354093 TTTTTTTTTGGGGGGGGTGGGGG + Exonic
1137423243 16:48354072-48354094 TTTTTTTTGGGGGGGGTGGGGGG + Exonic
1137529744 16:49271227-49271249 TTTTTTTTGGGGAGTGGTAGAGG - Intergenic
1137678645 16:50318766-50318788 TTTTGTCAGGGGTGGGTGGGAGG + Intronic
1138090828 16:54173067-54173089 TTTTTTGAGAGGTGGGTGGGCGG + Intergenic
1138178992 16:54930055-54930077 TTTTTCTAGAGTAGGGGTGGTGG - Intergenic
1138395205 16:56698694-56698716 TTTTTTTTTGGTAGGGATGGGGG - Intronic
1138427499 16:56945868-56945890 ATTTTTTAGGGGTGGGGGGGGGG - Intergenic
1138973373 16:62173137-62173159 TTTTGTTAGGGGAAAGTTGTAGG - Intergenic
1139018836 16:62723551-62723573 TTTTTTTTGGTGGTGGTTGGGGG + Intergenic
1139256352 16:65546614-65546636 CATTGTGAGGGGAGGGTTGGGGG + Intergenic
1139323052 16:66130832-66130854 TTTTTTGGGGGGTGGGGTGGAGG - Intergenic
1139409492 16:66747856-66747878 TTTCTTTAGGGCAGGCGTGGTGG - Intronic
1139456731 16:67085490-67085512 TTTTTTTTGGGTGGGGGTGGGGG + Intronic
1139456732 16:67085491-67085513 TTTTTTTGGGTGGGGGTGGGGGG + Intronic
1139760754 16:69182963-69182985 TTGATTTAGGAGAGGGCTGGAGG + Intronic
1139788332 16:69412047-69412069 TTTTTTTGGAGGAGGGTGAGAGG + Intergenic
1140413360 16:74755162-74755184 TTTTTTTTTGGCAGGGCTGGGGG + Intronic
1140699896 16:77572236-77572258 TTTTTTGGGGGGAGGGGAGGGGG + Intergenic
1140773830 16:78231153-78231175 TTTTTTAAGGGCTGGGGTGGAGG + Intronic
1140789826 16:78380793-78380815 TTTTTTCAGGGGGTGGTTTGGGG - Intronic
1140886281 16:79246533-79246555 TTTTTTTTGGGGGGGGTGTGGGG + Intergenic
1140886282 16:79246534-79246556 TTTTTTTGGGGGGGGTGTGGGGG + Intergenic
1141183610 16:81771674-81771696 TTTTTTGGGTGGGGGGTTGGGGG - Intronic
1141355861 16:83346175-83346197 GGTGTTTAGGGGAGTGTTGGAGG + Intronic
1141582357 16:85008497-85008519 TTTTTTTTGGGGGGGGGTGTAGG - Intronic
1141742195 16:85901096-85901118 TTGTTTTCGGGGAGTGTGGGGGG + Intronic
1143045529 17:4075817-4075839 TCTTTTGAGCGGGGGGTTGGGGG + Intronic
1143784068 17:9243880-9243902 TTTTTTTTGGGGGGGGGTGGGGG + Exonic
1143784069 17:9243881-9243903 TTTTTTTGGGGGGGGGTGGGGGG + Exonic
1144282506 17:13740447-13740469 ATAGTTTAGGGGAGGGTTCGTGG - Intergenic
1144330634 17:14220954-14220976 TTTTTACAGAGGAGGGTTTGAGG + Intergenic
1144680752 17:17192420-17192442 TTTTTTTTGGGGGGGGGGGGGGG + Exonic
1145115600 17:20208230-20208252 TATTTTTAGGTGAGAGTTTGAGG + Intronic
1145127545 17:20314686-20314708 TTTTTTTTGGGGGGGGAGGGGGG - Exonic
1145180002 17:20740048-20740070 TAATTTGAGGGGAGGGGTGGAGG + Intergenic
1145411091 17:22665477-22665499 TTTTTTTTTGGGTGGGGTGGGGG + Intergenic
1145885994 17:28382918-28382940 ATTTTTTTGTGGAGGCTTGGAGG + Intronic
1145939462 17:28735068-28735090 TTTTTTAGGGGGAGGGGAGGAGG - Intronic
1146069893 17:29670507-29670529 ATTTTTTAGGGCAGGTGTGGTGG + Intronic
1146155322 17:30518946-30518968 CTTTTTTTGGGGGGGGTTGGGGG - Intronic
1146243056 17:31248206-31248228 TTTTTTTTGGTGGGGGGTGGGGG - Intronic
1146465322 17:33081755-33081777 TTTATTTAGGGGTGGGGTGAGGG + Intronic
1146861773 17:36308324-36308346 TTTTTTTAGGAGAAGGTATGTGG + Intronic
1147009006 17:37428757-37428779 TTTTTGTAGGCCAGGCTTGGTGG + Intronic
1147092101 17:38112428-38112450 TTTTTTTAGGAGAAGGTATGTGG + Intergenic
1147105108 17:38208071-38208093 TTTTTTTAGGAGAAGGTATGTGG - Intergenic
1147165830 17:38592818-38592840 TTTTTTGTTGGGGGGGTTGGGGG + Intronic
1147260453 17:39207025-39207047 TTTTTTTGGTTGGGGGTTGGGGG - Intergenic
1147654223 17:42079664-42079686 TTTTTTTTGGGGGGTGATGGGGG - Intergenic
1148112495 17:45153829-45153851 TTTTTTTGGGGGGGGGGTGAGGG + Intergenic
1148389345 17:47259332-47259354 CTTTTTTTTGGGAGGGTGGGTGG + Intronic
1148424390 17:47580407-47580429 TTTTTTTAGGAGAAGGTATGTGG + Intronic
1148474398 17:47917379-47917401 TTTTTTCAGGGGATGGTGAGGGG + Intronic
1148624310 17:49057134-49057156 TTTATTTAGGGCAGGCGTGGTGG - Intergenic
1148752717 17:49954693-49954715 TTTTTGGAGGGGGGGGGTGGTGG + Intergenic
1149552245 17:57548903-57548925 TTTTTTTGGCGGGGGGGTGGGGG - Intronic
1150032519 17:61754450-61754472 TTTTTTTGGGTGGGGGCTGGAGG - Intronic
1150169492 17:62978328-62978350 CTTTTTTTGGGGAGAGTTAGGGG + Intergenic
1150466359 17:65396039-65396061 CTCTTTGAGGGGAGGGTTAGTGG + Intergenic
1150576789 17:66437726-66437748 TTTTTTGAGCGGGGGGTGGGTGG + Intronic
1150798822 17:68262467-68262489 TCTTTTTCTGGGGGGGTTGGGGG - Intronic
1151155988 17:72123330-72123352 TTTTATCAGGGGAGGGTCTGGGG - Intronic
1151369942 17:73641581-73641603 TTTTTTTTGGGGATGGGGGGTGG - Intronic
1151502203 17:74497803-74497825 TTTTTTTAGGCCAGGCGTGGTGG + Intergenic
1151838527 17:76600458-76600480 TTTTTTTAGGTGGGGCTGGGGGG + Intergenic
1152050765 17:77974477-77974499 TTTTTTTTGGGGCGGGGCGGGGG - Intergenic
1152111797 17:78360806-78360828 TTTTCATAGGGGAGGGGAGGGGG - Intergenic
1152188891 17:78876180-78876202 ATATTTTAGGGGAGGGCAGGGGG - Intronic
1152502569 17:80722430-80722452 GTTTTTAAGGGGAGGGTGGAAGG + Intronic
1153223208 18:2879666-2879688 TTTTTTGGGGGGGGTGTTGGGGG - Intronic
1153284922 18:3448732-3448754 TTTTTTTGAGGGAGGGTGGCAGG + Intronic
1153455795 18:5280730-5280752 TCTTTTTTGGGGAGGGTAGGGGG + Intergenic
1153995144 18:10434159-10434181 TTTTTTTTGCTGTGGGTTGGGGG - Intergenic
1154271480 18:12924165-12924187 TTTTTTTAGGCCAGGTGTGGTGG - Intronic
1154333764 18:13450321-13450343 TTTTTTGGGGGGGGGGGTGGGGG - Intronic
1155054814 18:22173338-22173360 TTGTTTGAGGGGAGGTGTGGGGG + Intronic
1155087198 18:22470436-22470458 TTTTTTTAGGGGCTGATGGGGGG - Intergenic
1155229064 18:23756449-23756471 TTTTTTTGGCGGGGGGGTGGGGG - Intronic
1155371182 18:25102780-25102802 CTTTTTTAAGTGAAGGTTGGTGG - Intronic
1155873688 18:31058442-31058464 TTTTCTTAGGGCAGGTTTGGTGG - Intergenic
1156376672 18:36521097-36521119 TTTTTTTGTGGGTGGGGTGGTGG + Intronic
1156416755 18:36902253-36902275 TTTTTTTGCTGGAGGGGTGGTGG + Intronic
1156553638 18:38043752-38043774 TTTTTTTGGGGGGGGGTGGGTGG - Intergenic
1156628058 18:38933677-38933699 TGTGTTTAGGGGAGGGTAGGTGG + Intergenic
1156765162 18:40644333-40644355 ATTTGTTAGGGGAGTGATGGAGG + Intergenic
1156793093 18:41003089-41003111 TTTTTTCAGGGCAGGCATGGTGG + Intergenic
1156839081 18:41590080-41590102 TTGTTTTTGCGGAGGGTTGTAGG + Intergenic
1156843243 18:41633570-41633592 CTCTTTTAGGGCAGGCTTGGTGG - Intergenic
1156929251 18:42621490-42621512 TTATTTTAGGGAAGGGTTAGGGG - Intergenic
1157874218 18:51256996-51257018 TTTTTTTGGGGCAGGGGTTGGGG + Intergenic
1157923944 18:51742459-51742481 TTCCTTTAGGGCAGGGCTGGTGG - Intergenic
1157927763 18:51784712-51784734 TTTTTTGGGGGGTGGGATGGGGG + Intergenic
1157984023 18:52417049-52417071 CTTTTTTAGGGCAGGCCTGGTGG + Intronic
1158074579 18:53513277-53513299 TTCTTTTAGGGCAGGCCTGGTGG - Intronic
1158111540 18:53945145-53945167 ATTATTTTGTGGAGGGTTGGGGG - Intergenic
1158330360 18:56355938-56355960 TTTTTTTTGGGAGGGGTGGGGGG - Intergenic
1158330361 18:56355939-56355961 TTTTTTTTTGGGAGGGGTGGGGG - Intergenic
1158368665 18:56771562-56771584 CTTTTTTTGGGGGGGGGTGGGGG - Intronic
1158714219 18:59863467-59863489 TTTTTTTTGGGGGAGGGTGGGGG - Intergenic
1159516048 18:69459093-69459115 TTTTTTGGGGGGGGGGTTGTTGG - Intronic
1159520336 18:69512187-69512209 TTTTTGTAAGAGAAGGTTGGGGG - Intronic
1159695788 18:71554320-71554342 CTTTTTTTGGGGGGGGATGGAGG + Intergenic
1160421099 18:78745488-78745510 TTATTTTGGTGGAGGGTAGGAGG + Intergenic
1160480752 18:79237682-79237704 TTTTTTTTGGGGGGGGGTGGGGG + Intronic
1160714580 19:570571-570593 GTTCTATAGGGGAGGGATGGAGG + Intergenic
1160787873 19:909794-909816 TTGTTTTTGGTGGGGGTTGGGGG - Intronic
1161462579 19:4407232-4407254 TTTTTTTGGGGGGGGTGTGGGGG - Intronic
1161462580 19:4407233-4407255 TTTTTTTTGGGGGGGGTGTGGGG - Intronic
1161872001 19:6877260-6877282 TTTTTTTGGGGGGGAGGTGGGGG + Intergenic
1162172209 19:8800023-8800045 CTTTTTTAGGGCAGGCCTGGTGG + Intergenic
1162207806 19:9069278-9069300 TTTTTTTATGTGGGGGTGGGTGG + Intergenic
1162415085 19:10531072-10531094 TTTTTTTTGGGGGGGGCTGTGGG + Intergenic
1163112810 19:15171514-15171536 TAATTTTTGGGGGGGGTTGGGGG + Intronic
1163457050 19:17413315-17413337 TTTGTTGAGGTGAGGGGTGGGGG - Intronic
1163645223 19:18485467-18485489 TGTTTTCAGGGGAGAGGTGGAGG - Intronic
1164231562 19:23293390-23293412 TTTTTTTGGGGGGGGGATGTAGG - Intergenic
1164284518 19:23801237-23801259 TTTTTTTAGGGGAGGGTTGGGGG + Intronic
1164866008 19:31605055-31605077 CTTCTTTAGGGGAGGGGAGGTGG + Intergenic
1164902713 19:31941650-31941672 TTTTTTTCAGGGTGGGATGGTGG - Intergenic
1165140044 19:33693761-33693783 TTCTTCTAGGGGAGTTTTGGGGG + Intronic
1165660042 19:37570105-37570127 GTCTTTTAGGGGAGGGTGGGTGG - Intronic
1165899608 19:39162957-39162979 TGTGGTTAGAGGAGGGTTGGGGG + Intronic
1165980446 19:39718119-39718141 CTCTTTTAGGGCAGGCTTGGTGG + Intergenic
1166143111 19:40816045-40816067 TTTTTTTTTTGGAGGGTTGGGGG - Intronic
1166366988 19:42282869-42282891 TTTTTTTCTGGGAGGGGGGGCGG + Intronic
1166495650 19:43301347-43301369 TTTTTTTGGGGGTGGGGAGGGGG + Intergenic
1166771093 19:45282817-45282839 TTTTTTAGGGGGCGGGGTGGCGG - Intronic
1167316833 19:48768615-48768637 TTTTTTTTTCGGAGGGGTGGAGG + Intergenic
1167351388 19:48977099-48977121 TTCTTTTGGGGGTGGGTGGGGGG + Intronic
1167840079 19:52109378-52109400 TTTTTTTAGGGGGGCGGTGATGG + Intergenic
1167891442 19:52542952-52542974 TTTTTTTGGGGGGGGGGTGGAGG + Intronic
1168289334 19:55349803-55349825 TTTTGTTGGGGGTGGGGTGGGGG - Exonic
925470904 2:4159641-4159663 CTCTTTTAGGGCAGGGCTGGTGG - Intergenic
926027490 2:9557387-9557409 TTTTTTTTGGGGGGGGGTGGTGG + Intergenic
926027491 2:9557388-9557410 TTTTTTTGGGGGGGGGTGGTGGG + Intergenic
926179198 2:10625708-10625730 TTTTTGTGGGGGTGGGGTGGAGG - Intronic
926217412 2:10914008-10914030 TCTGTCCAGGGGAGGGTTGGGGG - Exonic
926259761 2:11248207-11248229 TTTTTTTTGGGGGGGGATGGGGG + Intronic
926259762 2:11248208-11248230 TTTTTTTGGGGGGGGATGGGGGG + Intronic
926306555 2:11641136-11641158 TTTTTTGGGGGGGGAGTTGGCGG + Exonic
926391636 2:12399943-12399965 TTTTTTGAGGGTGGTGTTGGAGG + Intergenic
926772900 2:16393885-16393907 ATCTTCTTGGGGAGGGTTGGGGG + Intergenic
926900486 2:17746577-17746599 TTTTTTTAGGGAAGAGTTAAAGG - Intronic
927284075 2:21337879-21337901 CTCTTTTAGGGCAGGCTTGGAGG - Intergenic
927403134 2:22737135-22737157 TTTTTTTTGCGGGGGGGTGGGGG + Intergenic
927403135 2:22737136-22737158 TTTTTTTGCGGGGGGGTGGGGGG + Intergenic
927411475 2:22831083-22831105 ATTTTTTTGGGGGGGGGTGGGGG - Intergenic
927525747 2:23738514-23738536 CTCTTTTAGGGCAGGGCTGGTGG - Intergenic
927557253 2:24044269-24044291 TTTTTTTGGGGGGGGCGTGGGGG + Intronic
927823831 2:26293317-26293339 TTTGTTTTGGGGTGGGGTGGGGG + Intergenic
928156241 2:28879683-28879705 TTTTTTTAGGCCAGGCTTGGTGG - Intergenic
928219431 2:29391299-29391321 TTTTTTTGGGGGGGGGGTGGTGG + Intronic
928516095 2:32046243-32046265 TTTTTGTATGTGAGTGTTGGGGG - Intergenic
928523995 2:32121149-32121171 TTTTTTTAGGTGGGGGCAGGGGG + Intronic
928535011 2:32231568-32231590 TTTTTGTGGGGGGGGGGTGGGGG + Intronic
928554997 2:32414377-32414399 TTTTTTTAGGCCAGGCGTGGTGG + Intronic
928673001 2:33621663-33621685 GTTTTTTGGCGGAGGGGTGGCGG - Intergenic
928715071 2:34050882-34050904 TTTTTTTGGGGGGGAGGTGGGGG + Intergenic
928957844 2:36889611-36889633 TTTTTTTTGGGGGGGGTGGGGGG + Intronic
929478863 2:42282382-42282404 TTTTTTTGGTGGAGGGGTGGGGG + Intronic
929630267 2:43452913-43452935 TTTTTTTGGGGGTGGGTGGAGGG - Intronic
929716442 2:44315489-44315511 TTTTTTTTGGCGGGGGTAGGGGG - Intronic
929770673 2:44889031-44889053 TTTTTTTGGGGGTGGGTAGATGG + Intergenic
929774057 2:44917088-44917110 CAATCTTAGGGGAGGGTTGGGGG + Intergenic
929957079 2:46466256-46466278 TTTTTTTGGGGGGGGGTGCGGGG - Intronic
929957080 2:46466257-46466279 TTTTTTTTGGGGGGGGGTGCGGG - Intronic
930098846 2:47587710-47587732 TTTTTTTATAGAAGGGTTTGGGG + Intergenic
930572677 2:53107227-53107249 TTTTTTTGGGGGGGGGGGGGCGG - Intergenic
930710213 2:54543777-54543799 TTTTTTTTGGGGTGGGAGGGGGG - Intronic
931201617 2:60103177-60103199 TTTTTTTTGGGGGGGGGTGGGGG + Intergenic
931201618 2:60103178-60103200 TTTTTTTGGGGGGGGGTGGGGGG + Intergenic
931326544 2:61231285-61231307 TTTTTTTTGGTGGGGGGTGGGGG + Intronic
931507841 2:62951527-62951549 TTTTTTTTGGGGGGGGGGGGTGG + Intronic
931646913 2:64431787-64431809 TTTTTTTATGGTAGGTTTGCTGG + Intergenic
931825543 2:65996717-65996739 TTTTTTTTGGGGTGGGTTTAAGG - Intergenic
931960487 2:67477254-67477276 TTTTTTGAGGGGTGGGGGGGGGG - Intergenic
932181643 2:69651810-69651832 TTTTTTTTGGGGGGGGGGGGCGG + Intronic
932293354 2:70603607-70603629 TTCTTTTAGGGTAGGTTTGTTGG + Intergenic
932390395 2:71384608-71384630 CTTCTTTTGGGGAGAGTTGGAGG + Intronic
932541106 2:72653592-72653614 TCTTTTTGGGGGGGGGTTGCTGG - Intronic
932565690 2:72906923-72906945 TTTTTTTTGGCGGGGGTGGGGGG + Intergenic
932875477 2:75446828-75446850 TTTCTTTAGGTGAGGATTGTGGG + Intergenic
932930742 2:76034864-76034886 TTATTTTTGGAGAGGGCTGGAGG - Intergenic
932934515 2:76086572-76086594 TTTTTTTGGGGGGGGGTGGGGGG - Intergenic
932934516 2:76086573-76086595 TTTTTTTTGGGGGGGGGTGGGGG - Intergenic
933314080 2:80695186-80695208 TTTTTCTTTGGGAGGATTGGAGG - Intergenic
933458451 2:82547589-82547611 TTTTTTCATGGGAGGTTTGGGGG - Intergenic
933501277 2:83114788-83114810 TTTTTTGAGGGTAGTGGTGGGGG - Intergenic
933855778 2:86412713-86412735 TTTTTTTAGGCCAGGCGTGGTGG - Intergenic
934025224 2:87996827-87996849 TTTTTTTGGCGGGGGGGTGGGGG + Intergenic
934123388 2:88862252-88862274 TTTCTTTTGGGGTGGGCTGGGGG + Intergenic
934863383 2:97783281-97783303 TTTTTTTAGGGTAGGTCTGTTGG - Intronic
935225206 2:101046954-101046976 TTTTTTTTGGGGAGGGTAGTTGG - Intronic
935310287 2:101776574-101776596 TTTTTTTTTGGGGGGGTGGGGGG - Intronic
935586284 2:104802661-104802683 TTTTTATGGGGAAGTGTTGGTGG + Intergenic
935811940 2:106807006-106807028 GTTTTTTGGGGGAGGGGTGGTGG + Intronic
936089158 2:109489731-109489753 TTTTTTTGGCGGGGGGTGGGCGG + Intronic
936280068 2:111131203-111131225 TTTTTTTTGGCGGGGGATGGGGG + Intronic
936467857 2:112769474-112769496 TTCTTTTCTGGGAGGGTTGGGGG - Intergenic
936639194 2:114293220-114293242 TTTCTATAGGGGAGGGGTTGGGG - Intergenic
937204131 2:120224757-120224779 TCTGTTTAGGGGAGGAATGGAGG - Intergenic
937556581 2:123165498-123165520 TTTTTTTTCGGGGGGGGTGGGGG + Intergenic
937556582 2:123165499-123165521 TTTTTTTCGGGGGGGGTGGGGGG + Intergenic
937592478 2:123630545-123630567 CTTTTTTAGGGCAGGACTGGTGG - Intergenic
938704668 2:133912309-133912331 CTCTTTTAGGGCAGGCTTGGTGG - Intergenic
938751438 2:134334510-134334532 TTTTTTTTTTGCAGGGTTGGGGG + Intronic
938820184 2:134949796-134949818 TTTTTTCGGGGGGGGGGTGGGGG + Intronic
939267725 2:139895140-139895162 TTTTTTTTGGGGGGGGTTGGTGG - Intergenic
939334192 2:140803869-140803891 TTTTTTTTGGGGGGGTTGGGGGG - Intronic
939334193 2:140803870-140803892 CTTTTTTTTGGGGGGGTTGGGGG - Intronic
939367516 2:141252192-141252214 TTTTTTTAGGGGGTGGGGGGTGG - Intronic
939417565 2:141920273-141920295 TTTTTTTGGGGGGGGGTGGTAGG + Intronic
939619775 2:144404361-144404383 TTTTTTTTTGGGGGGGTGGGGGG + Intronic
939927014 2:148187299-148187321 TTTTTTTGGGGGGGGTATGGAGG - Intronic
940511409 2:154620125-154620147 TTTTTTTGGGGGGGGGGGGGTGG - Intergenic
940675139 2:156718142-156718164 TTTTTTTTTGGGAGGGGTGCGGG - Intergenic
940845909 2:158642019-158642041 TTTTTTTGGTGGGGGGTGGGGGG + Intronic
941290496 2:163668008-163668030 TTTTTGGGGGGGGGGGTTGGAGG - Intronic
941437308 2:165487760-165487782 TTCTTTTAGGGCAGGCCTGGTGG - Intronic
942031597 2:171967891-171967913 TTTTTTTTGGTGGGGGTGGGTGG - Intronic
942235926 2:173904845-173904867 TTTTTGTGGGGGAAGGATGGAGG + Intergenic
942385881 2:175442260-175442282 TTTCTTTAAAAGAGGGTTGGTGG - Intergenic
942891850 2:180999630-180999652 TTTTTTTTTGGGAGGGGTGGAGG - Intronic
942994975 2:182249725-182249747 TTTTTTGGGGGGGGGGTTGGGGG - Intronic
942994976 2:182249726-182249748 TTTTTTTGGGGGGGGGGTTGGGG - Intronic
943059044 2:183018537-183018559 GTGTTTTAGGGGTGGGGTGGTGG - Intronic
943071169 2:183142458-183142480 TTTTTTTTGGTGGGGGGTGGTGG + Intronic
943850603 2:192717367-192717389 TTTTTTGGGGGGAGGGATTGAGG + Intergenic
944249499 2:197567148-197567170 TTTTTTTGGAGGTGGGTGGGTGG + Intergenic
944898926 2:204194980-204195002 TTTTTTTGGTGGGGGGTGGGCGG + Intergenic
944918478 2:204385789-204385811 TTCTTTTAGGGCAGGCCTGGTGG - Intergenic
945219297 2:207467838-207467860 TTTTTTTTTGGGAGGGGTGATGG - Intergenic
945289112 2:208110376-208110398 TTTTTTTAGGCCAGGCGTGGTGG - Intergenic
945421165 2:209638461-209638483 TTTTTCTAGGGGTGGATTTGGGG - Intronic
945552103 2:211233055-211233077 ATTTTTCAGGGTAGGGATGGTGG + Intergenic
945691412 2:213041332-213041354 CTTTTTTTGGGGGGGGTGGGAGG + Intronic
945717914 2:213381258-213381280 TTCCTTTAGGGAAGGCTTGGAGG + Intronic
945887995 2:215397327-215397349 TATTTTTATGGGAGGGAGGGAGG - Intronic
945894892 2:215470759-215470781 TTTTTTTTGGGGGGGGGGGGCGG - Intergenic
945992119 2:216404931-216404953 CTTTTTTTTGGGGGGGTTGGGGG + Intergenic
945992120 2:216404932-216404954 TTTTTTTTGGGGGGGTTGGGGGG + Intergenic
946138210 2:217665597-217665619 TTTGTTGTGGGCAGGGTTGGTGG + Intronic
946241341 2:218357774-218357796 TTGGTGGAGGGGAGGGTTGGAGG - Intronic
946452631 2:219794186-219794208 TTTTTTTTGGGAGGGGGTGGTGG + Intergenic
946488949 2:220129308-220129330 TTTTTTTTTGGGGGGGGTGGCGG + Intergenic
946549310 2:220783136-220783158 TTCTGTTAGGGGAGGGTTGTTGG + Intergenic
946608798 2:221436127-221436149 TTTTTTTTTGGGAGGGCAGGGGG - Intronic
946655213 2:221939064-221939086 TGCTGTTAGGTGAGGGTTGGGGG - Intergenic
946946935 2:224831220-224831242 TTTGTTTAGGTCAGGCTTGGTGG - Intronic
947211774 2:227715244-227715266 TTTTTTTTGGGGGGGGTGTGGGG - Intronic
947255487 2:228159307-228159329 GTTTTTAAGAGCAGGGTTGGGGG + Intronic
947393213 2:229661302-229661324 TTTTTTTTGGGGAGGTGTGGGGG - Intronic
948555660 2:238808775-238808797 TTCTTTTAGGGTAGGCTTGACGG + Intergenic
948573862 2:238937298-238937320 CTTTTTTAGGATAGGCTTGGTGG - Intergenic
948749354 2:240122077-240122099 TATTTTCATGGCAGGGTTGGTGG + Intergenic
948818848 2:240528288-240528310 TTTTTTTGGGGGGGGGGTGGGGG - Intronic
948997346 2:241589240-241589262 TTTTTTTTGGTGGGGGTGGGGGG - Intronic
1168771348 20:418984-419006 TTTTTTTTGGCGGGGGTTGGGGG + Intronic
1168835675 20:875764-875786 TGTTTGTATGGCAGGGTTGGGGG + Intronic
1168953188 20:1816746-1816768 TTTTTTCAGTGCAGGGTTGGAGG - Intergenic
1168959778 20:1860885-1860907 TTTCTTCAGGGGAGTGGTGGTGG + Intergenic
1169114219 20:3052547-3052569 TTTTTTTGGTGGGGGGGTGGGGG - Intergenic
1169660695 20:7975447-7975469 TTTTTTTGAGGGAGGGATGGAGG - Intergenic
1169703943 20:8481110-8481132 TTCTTTTTTGGGAGGGTGGGGGG - Intronic
1169928926 20:10811255-10811277 TCTTTTTGGGGGAGAGGTGGGGG - Intergenic
1169986949 20:11455799-11455821 TTTTTTTTTGGTAGGGGTGGAGG + Intergenic
1170090463 20:12584335-12584357 CTCTTTTAGGGCAGGCTTGGTGG - Intergenic
1170241264 20:14169302-14169324 TTTTTTTTGGGGGGGGGCGGTGG + Intronic
1170494712 20:16913834-16913856 GTTGTTTTGGGGAGGGTTGAAGG - Intergenic
1171189186 20:23146618-23146640 TTTTTTTGGCGGGGGGTGGGGGG - Intergenic
1171189187 20:23146619-23146641 TTTTTTTTGGCGGGGGGTGGGGG - Intergenic
1171912286 20:30974626-30974648 CTTTTTTAGGGCAGGCCTGGTGG + Intergenic
1171996417 20:31735250-31735272 TTTTTTTAGTGGAGGGTTGGGGG + Intergenic
1172040874 20:32044829-32044851 TTTTTTTGGGGGGGGGTGGCAGG - Intergenic
1172389556 20:34557927-34557949 TTTTTTTGGGGGAGGGGGGAGGG - Intronic
1172711920 20:36931635-36931657 TTTTTTGGGGGGAGGGTGGTGGG - Intronic
1172711921 20:36931636-36931658 TTTTTTTGGGGGGAGGGTGGTGG - Intronic
1172881204 20:38201003-38201025 TTTTTTTTGGGGGGGGGGGGTGG + Intergenic
1173211322 20:41034884-41034906 TTTTTTTTTGGGCGGGGTGGGGG + Intronic
1173211323 20:41034885-41034907 TTTTTTTTGGGCGGGGTGGGGGG + Intronic
1173536333 20:43816289-43816311 CTCTTTTAGGGCAGGCTTGGTGG - Intergenic
1173623155 20:44451744-44451766 TTTTTTTTGGGGGGGGTGGGGGG - Intergenic
1174014602 20:47477644-47477666 TTTTTTGGGGGGATGGGTGGGGG - Intergenic
1174331382 20:49821766-49821788 TTTTTTTGCCGGGGGGTTGGTGG + Intronic
1174458581 20:50667012-50667034 TGTTTGTAGGGGAGGTTAGGAGG - Intronic
1174535385 20:51247450-51247472 TTTTTTTTGGCGGGGGGTGGGGG - Intergenic
1174753098 20:53131820-53131842 TTTTTTTTGGGGGGGGGGGGGGG - Intronic
1175311509 20:58014974-58014996 TTTTTTTAGGGTGGGGTTGGGGG - Intergenic
1175606913 20:60318602-60318624 TATTCTGAGGGGAGGGCTGGGGG - Intergenic
1175672045 20:60911748-60911770 TTTTTTTTTGGGGGGGTGGGGGG + Intergenic
1175878678 20:62243864-62243886 TTTTTTTTGCAGAGGGTAGGGGG + Intronic
1175879538 20:62249212-62249234 TTTTTTTTTTGGGGGGTTGGGGG - Intronic
1176067726 20:63207467-63207489 TTTTTTTGGAGGGGGGTGGGGGG - Intronic
1176067727 20:63207468-63207490 TTTTTTTTGGAGGGGGGTGGGGG - Intronic
1176650778 21:9545065-9545087 TTTTTTTGGGGGGGGGGGGGCGG + Intergenic
1176669635 21:9720904-9720926 TTTTTTTGGGGGGGGGTGGGAGG + Intergenic
1176670421 21:9728842-9728864 CATGTTTAGGGGAGGGTTGTTGG + Intergenic
1176947002 21:14994118-14994140 TTTTTTTGGGGGTGGGGTGGGGG + Intronic
1177132330 21:17273365-17273387 TTCTTTTAGGGCAGGCCTGGTGG - Intergenic
1177907630 21:26991540-26991562 TTTTTTTTGGGGGGTGGTGGGGG + Intergenic
1177907631 21:26991541-26991563 TTTTTTTGGGGGGTGGTGGGGGG + Intergenic
1177914200 21:27067983-27068005 CTATTTGAGGGGAGGGTGGGGGG + Intergenic
1178121835 21:29477136-29477158 TTTTTTTTTGGGGGGGGTGGGGG + Intronic
1178275160 21:31230389-31230411 TTTTTTAAGAACAGGGTTGGTGG - Intronic
1178490757 21:33049946-33049968 TTTCTTTAGGGGAGGGCTGTTGG - Intergenic
1178566721 21:33693354-33693376 TTTTTTTGGTGGGGGGGTGGGGG + Intronic
1178599275 21:33982035-33982057 CTTTTTTGGCGGAGGGATGGGGG + Intergenic
1178797921 21:35762728-35762750 TTTTTTTAAAAGAGGTTTGGTGG - Intronic
1178995594 21:37396218-37396240 TTTTTTTAGGTTGGGGATGGAGG + Intronic
1179172144 21:38981074-38981096 TTATCTTAAGGGAGGGCTGGTGG - Intergenic
1179605739 21:42514098-42514120 TTTTTTTCGGGGGGAGGTGGGGG + Exonic
1179829064 21:43984687-43984709 TTTTTTTGGGGGGGGGAGGGTGG + Exonic
1180654325 22:17406528-17406550 TTTTTTGGAGGGAGGGGTGGGGG - Intronic
1182573606 22:31257993-31258015 TTTTTCTAGGGGAGGCTTCTTGG + Intronic
1182776061 22:32831850-32831872 TTTTTTTGGTGGAGGTTGGGGGG - Intronic
1182836745 22:33348274-33348296 TTTTTTTGGGGGGGGGTGGGTGG - Intronic
1182908472 22:33959055-33959077 TTTCTTTTGGGGGGGGTTGGGGG + Intergenic
1183804128 22:40193846-40193868 TTTTTTTTTTGGAGGGTGGGTGG - Intronic
1183968734 22:41459902-41459924 TTTTTTGGGGGGGGGGTGGGGGG - Exonic
1183968735 22:41459903-41459925 TTTTTTTGGGGGGGGGGTGGGGG - Exonic
1184156342 22:42670021-42670043 TTTTTTGGGGGGTGGGGTGGGGG - Intergenic
1185429274 22:50796314-50796336 TTTTTTTTGGGGGGGGGGGGGGG - Intergenic
949358097 3:3202842-3202864 TTTTTTTTGGTGGTGGTTGGGGG - Intergenic
949414849 3:3802457-3802479 TTTTTTCTGGCGGGGGTTGGGGG - Intronic
949540547 3:5028733-5028755 TATTTTTAGGCGAGGCGTGGTGG - Intergenic
949595076 3:5534604-5534626 TTTTTTTAGGGGAGAATTTGTGG + Intergenic
950260573 3:11540901-11540923 TTTTTTTGGGGGGGGGAGGGGGG + Intronic
950279298 3:11692734-11692756 TTTTTTTGAGGGGGGGTGGGGGG + Intronic
950591933 3:13942827-13942849 TTTTTTTTGTGGTGGGTTGTGGG + Intronic
950605149 3:14072043-14072065 TTCTTTTAGGGCAGGCCTGGTGG - Intronic
950781393 3:15395676-15395698 TTCTTTTAGGGCAGGCCTGGTGG + Intronic
950912175 3:16605654-16605676 TTATTTTAGGGGTGTTTTGGGGG - Intronic
950998239 3:17528048-17528070 GTTTTTTAGGGGGGGCTGGGAGG + Intronic
951580557 3:24158427-24158449 TTTTTTTGGGGGGAGGGTGGGGG + Intronic
951695411 3:25441080-25441102 TTTTTTTTCGGGGGGGTGGGTGG + Intronic
951792990 3:26507177-26507199 TTTTTTTGGGGGGGCGGTGGGGG + Intergenic
951989625 3:28662226-28662248 GTTTTTTTGGGGAGGATTAGGGG + Intergenic
952169668 3:30792852-30792874 TTAGTTTAGGGGAGGGTATGTGG - Intronic
952207007 3:31190340-31190362 TTTTTTTAGTTGGGGGGTGGGGG - Intergenic
952271726 3:31839460-31839482 TCTTTTTAGGGGGTGGTGGGTGG - Intronic
952385631 3:32839655-32839677 TTTTTTTGGGGGGGGGGTGGGGG + Intronic
952709313 3:36413851-36413873 CTCTTTTAGGGCAGGGCTGGTGG + Intronic
952784243 3:37136949-37136971 TCTTTTTTGGGGGGGGTGGGGGG + Intronic
953015577 3:39072710-39072732 TTTTTCTAGTGGAAGGATGGAGG + Intronic
953043391 3:39274467-39274489 TTTTTTTTGGTGGTGGTTGGAGG - Intronic
953168770 3:40488657-40488679 TTTTTTTAGGGGGTGGGGGGTGG + Exonic
953871694 3:46632330-46632352 GTTTGTTAGGGGTGGGGTGGAGG - Intergenic
953933024 3:47015973-47015995 CTTTTTTTGGGGGGGGGTGGGGG - Intergenic
954050834 3:47975746-47975768 TTTTATTTGGGGAGGGAAGGTGG - Intronic
954138999 3:48595407-48595429 TTTGTCTGGGGGAGGGGTGGGGG - Intergenic
954436834 3:50500750-50500772 TTTTTTTGGGCGGGGGGTGGGGG - Intronic
954448976 3:50561560-50561582 TTTCCTTTGGGGAGGGTTGAGGG - Intronic
954590140 3:51776066-51776088 TTTATTTATGGGAGGGCTGTGGG + Intergenic
954728707 3:52638979-52639001 TTTTTTTTGGGGGGGGGGGGCGG + Intronic
954966383 3:54614845-54614867 GTTTTTTTGGGGAGTGGTGGAGG - Intronic
955235635 3:57136626-57136648 TTTTTTTGAGTGGGGGTTGGGGG - Intronic
955282272 3:57604610-57604632 TTTTTTTTGGGGGGGGTGGGTGG + Intergenic
955427638 3:58808529-58808551 CTCTTTTAGGGCAGGGCTGGTGG - Intronic
955762473 3:62302432-62302454 ATTTTTTTGGGGGGGGTGGGAGG - Intergenic
956082961 3:65579007-65579029 TTTTTGCGGGGGAGGGGTGGGGG + Intronic
956668552 3:71664390-71664412 TTTTTTTTGGTGGGGGGTGGGGG + Intergenic
956668553 3:71664391-71664413 TTTTTTTGGTGGGGGGTGGGGGG + Intergenic
957055542 3:75439919-75439941 CATTTTTAGGGGAAGGGTGGGGG + Intergenic
957143378 3:76390175-76390197 TTTTTGTGGGGGAGGGTGTGGGG - Intronic
957367515 3:79245622-79245644 TTTTTTGAGGGGTGGGGTGGGGG - Intronic
957554677 3:81751097-81751119 TTTTTTTGGCGGAGGGCCGGGGG - Intronic
957982593 3:87528811-87528833 TTTTTTTTGGGAAGAGTTTGAGG + Intergenic
958027386 3:88064461-88064483 TTTTGTTAGGGGAGGGATCTGGG + Intronic
959348729 3:105232996-105233018 TTTTTTTGGGGGGGGGTAGTGGG - Intergenic
959348730 3:105232997-105233019 TTTTTTTTGGGGGGGGGTAGTGG - Intergenic
959669309 3:108956771-108956793 TTTTTTTAGATGGGGGTTTGTGG - Intergenic
959823243 3:110762105-110762127 GTTTTTTTGGGGGGGGTTGCTGG + Intergenic
959835639 3:110915615-110915637 CTCTTTTAGGGCAGGCTTGGTGG + Intergenic
959963742 3:112331754-112331776 TTTTTTTGGGGGGGGGGCGGTGG - Intergenic
960113593 3:113870363-113870385 TTTTTTGAGCGGGGGTTTGGGGG - Intronic
960187664 3:114663353-114663375 CTCTTTTAGGGCAGGCTTGGTGG - Intronic
960248809 3:115429170-115429192 TTTTTGTAGGGGACGGGTGGTGG + Intergenic
960495697 3:118371402-118371424 TTTTTTGAGGGGGGATTTGGGGG + Intergenic
960546082 3:118916071-118916093 CTCTTTTAGGGCAGGCTTGGTGG - Intronic
960574840 3:119219214-119219236 CTTTTGCAGGGGAGGGTTGAAGG + Intronic
961019547 3:123493470-123493492 TTTTTTTGGGGGCAGGGTGGGGG - Exonic
961096517 3:124161167-124161189 CTTTTTTGGGGGAGGGATGGAGG - Intronic
961298846 3:125908686-125908708 CATTTTTAGGGGAAGGGTGGGGG - Intergenic
961473367 3:127132345-127132367 TTTTTTTAGAGGGGTGCTGGGGG - Intergenic
961507368 3:127378969-127378991 TTTTATTAGGGAAAGGTTGATGG + Intergenic
961588563 3:127957638-127957660 TTTTTTTTGGTGGCGGTTGGGGG - Intronic
961889215 3:130116304-130116326 CATTTTTAGGGGAAGGGTGGGGG + Intergenic
961956223 3:130806581-130806603 TTCTTTTAGGGCAGGCCTGGTGG - Intergenic
962018223 3:131466683-131466705 TTTTTTTTGGGGGGGGGTGGGGG + Intronic
962030837 3:131598844-131598866 TTTTTTTGGCGGGGGGGTGGGGG - Intronic
962045138 3:131750816-131750838 TTCTTTTAGGGTAGGTTTGCTGG + Intronic
962536665 3:136335113-136335135 TTTTTTTCGGGGGGGGGGGGGGG - Intronic
963115411 3:141724743-141724765 TTTTTTGGGGGGTGGGGTGGGGG - Intergenic
963439975 3:145327393-145327415 CTTATTTCGGTGAGGGTTGGGGG + Intergenic
963854671 3:150241257-150241279 TTTTTTTTGGTGGGGGGTGGGGG + Intergenic
963943844 3:151123482-151123504 TTTTTATAGGGGAGGGGATGTGG + Intronic
964178221 3:153851757-153851779 TTTTTTTCCGGGCGGGATGGGGG - Intergenic
964387893 3:156168204-156168226 CTTTTTTGGGGGGCGGTTGGGGG - Intronic
964416185 3:156450857-156450879 TTTTTTTGGGGGGGGGTGGGTGG - Intronic
964849681 3:161081743-161081765 TTTTTTGGGGGGAGTGTGGGGGG + Intergenic
965657460 3:171003437-171003459 TTTTTGGGGGGGAGGGTGGGAGG + Intronic
965750391 3:171969619-171969641 ATTTTTTTGGGGGGGGTTGTCGG - Intergenic
966036912 3:175429023-175429045 TTTTTTCTGGAGAGGGATGGAGG + Intronic
966188373 3:177248303-177248325 TTTTTTGTGGGGGGGGTGGGGGG - Intergenic
966456936 3:180128141-180128163 TTTTTTTTGGGGGGGTGTGGGGG - Intergenic
966560802 3:181317986-181318008 TTTTTTGGGGGGTGGGTGGGTGG - Intergenic
966614219 3:181897019-181897041 TTTTTGGGGGGGGGGGTTGGGGG - Intergenic
967075673 3:185999822-185999844 TTTTTTTCTGGGGGGGTGGGGGG - Intergenic
967166473 3:186784017-186784039 TTTACTTGGGGAAGGGTTGGAGG + Intronic
967724529 3:192849310-192849332 TTTTTTTGGGGGGGGGGCGGGGG + Intronic
967864588 3:194179807-194179829 TTTTTTTTGGGGGGGGTGGGGGG - Intergenic
967864589 3:194179808-194179830 TTTTTTTTTGGGGGGGGTGGGGG - Intergenic
968015431 3:195327924-195327946 TTTTTTTGGTGGAGGGCTGATGG - Intronic
968018986 3:195367039-195367061 TTTTTTTTTGGCGGGGTTGGGGG - Intronic
968083043 3:195860144-195860166 TTGTTTTGGGGGTGGGTTAGAGG - Intergenic
968164938 3:196457061-196457083 TTTTTTTTTGGCAGGGTGGGTGG - Intergenic
968431093 4:559620-559642 TTCTTTTTTGGGGGGGTTGGGGG - Intergenic
968721546 4:2210276-2210298 TTTTTTAAGGGGATGATTGTGGG + Intronic
968998355 4:3960227-3960249 CATTTTTAGGGGAAGGGTGGGGG + Intergenic
969111069 4:4844605-4844627 TTGTGGCAGGGGAGGGTTGGGGG - Intergenic
969250812 4:5967549-5967571 TTTTTTGCGGGGAGGGGTGATGG - Intronic
969286011 4:6202208-6202230 TTTTTTGAGGGGGTGGGTGGGGG - Intergenic
969755644 4:9148425-9148447 CATTTTTAGGGGAAGGGTGGGGG - Intergenic
969803564 4:9588550-9588572 TTTTTTTGGGGGGGGGCAGGGGG + Intergenic
969815533 4:9684550-9684572 TACTTTTAGGGGAAGGGTGGGGG - Intergenic
969950418 4:10829931-10829953 ATATTTTAGGGCAGGGTTGTTGG - Intergenic
970139245 4:12962543-12962565 TTTGTATAGGAGAGGCTTGGTGG - Intergenic
970288767 4:14549114-14549136 TTTTTTTTGGTGGGGGTTGTGGG - Intergenic
971078473 4:23178657-23178679 TTTTTTGGGGGGGGGGGTGGTGG - Intergenic
972093766 4:35322445-35322467 CTTTTTTAGGGCAGGCCTGGTGG - Intergenic
972144805 4:36009874-36009896 TTTTTTTGGCGGGGGGTAGGGGG + Intronic
972581494 4:40399353-40399375 TTTTTTTTGAGTGGGGTTGGGGG - Intergenic
972668517 4:41191425-41191447 GATTTTTAAAGGAGGGTTGGGGG - Intronic
972810093 4:42574523-42574545 TCTTATTAGGGGAGGGTATGGGG - Intronic
972902493 4:43701447-43701469 TGTGTGTGGGGGAGGGTTGGGGG + Intergenic
972951099 4:44323494-44323516 TTTTTTTGGGGGGGGGTGGGTGG - Intronic
973132616 4:46666524-46666546 ATTTTTTAGGGCAGGCCTGGTGG - Intergenic
973679336 4:53299913-53299935 CTCTTTTAGGGCAGGCTTGGTGG - Intronic
973857227 4:55024895-55024917 TTTTTTGAGGTGGGGGTGGGGGG + Intergenic
973884804 4:55309643-55309665 TTTTTTTTTGGTAGGGATGGAGG - Intergenic
974140728 4:57883207-57883229 TTTTTACAGGGGAGGGTGGATGG + Intergenic
974179189 4:58362218-58362240 TTTTTTTGGGGCGGGGGTGGGGG + Intergenic
974491828 4:62573168-62573190 TGTTATTAGGGGAGTGGTGGTGG + Intergenic
974830143 4:67178863-67178885 CTCTTTTAGGGCAGGCTTGGTGG - Intergenic
974917479 4:68196012-68196034 TTCTTTTAGGGCAGGCCTGGTGG - Intergenic
975034431 4:69662768-69662790 TTCTTTTAGGGCAGGCCTGGTGG - Intergenic
975143103 4:70938320-70938342 TTTTTTTTGGGGGGGGGGGGGGG - Intronic
975545593 4:75557177-75557199 TTTTAGTAGGTGAGGCTTGGGGG - Intronic
975711137 4:77160524-77160546 TTTTTTTTGGGGGGGGGGGGAGG + Intronic
975806342 4:78117007-78117029 TTCTTTTAGGGCAGGCCTGGTGG + Intronic
976422307 4:84859860-84859882 TTTTTTTAGGCCAGGCGTGGTGG - Intronic
976574591 4:86655418-86655440 CTCTTTTAGGGCAGGCTTGGTGG + Intronic
976612827 4:87047382-87047404 CTTTTTGAGGGGAGGGAGGGAGG - Exonic
976682353 4:87771035-87771057 CTCTTTTAGGGCAGGCTTGGTGG - Intergenic
976938886 4:90675662-90675684 TTTTTTTTGGCTTGGGTTGGTGG + Intronic
976980880 4:91226722-91226744 TTTTCTTAGGGTGGGGTTGTTGG + Intronic
977077527 4:92474961-92474983 TTTTTTTGGGGGGGGGGTGGAGG + Intronic
977268693 4:94887389-94887411 TTTTTTTTGGTGGGGGGTGGGGG - Intronic
977398687 4:96503612-96503634 TTTTTTTGGTGGAGGGTTGGGGG + Intergenic
977562300 4:98544895-98544917 TATGTTCAGGGGAGGGATGGTGG + Intronic
977564632 4:98568544-98568566 TTTTTTTTGTGGTGGGTTGGTGG - Intronic
978006438 4:103622735-103622757 CTTTTTTATGTGGGGGTTGGAGG - Intronic
978088967 4:104691065-104691087 CTTTTTTAGGGCAGGCCTGGTGG + Intergenic
978140358 4:105311421-105311443 TTCTTTTAGGGCAGGCCTGGTGG + Intergenic
978478334 4:109158350-109158372 TTTTAGTTGGGGAGAGTTGGAGG - Intronic
978632335 4:110761660-110761682 TTCTTTTAGGGCAGGCCTGGTGG + Intergenic
978990737 4:115078844-115078866 TTTTTTTGGGCGGGGGTTGGTGG - Intronic
979116676 4:116832889-116832911 TTTTTTTTGGGGGGGGTGGGGGG + Intergenic
979166381 4:117536840-117536862 TTTTTTTGGGGGGGGGTTGGAGG - Intergenic
979335916 4:119462594-119462616 TTCTTTTAGTGGAGAGATGGTGG - Intergenic
979557145 4:122061972-122061994 TTTTTTTGGGGGGGGGGCGGGGG + Intergenic
979762101 4:124419135-124419157 TTTTTTTTGGTGGGGGTGGGGGG + Intergenic
979843739 4:125481380-125481402 TTTTTTAAGAGTAGAGTTGGGGG + Intronic
980781595 4:137498093-137498115 CTCTTTTAGGGGAGGTCTGGTGG - Intergenic
980804119 4:137789951-137789973 TTTTTTTTGGGGGGGGAGGGGGG - Intergenic
981237433 4:142435469-142435491 TTTATTTGGGGGAGGGGGGGTGG + Intronic
981252142 4:142616146-142616168 TTTCATTGGGTGAGGGTTGGGGG - Intronic
981571685 4:146158333-146158355 TTTTTTTAAGTGAGGGGTGAAGG + Intergenic
981762490 4:148209457-148209479 TTTTTTGCGGGGTGGGTGGGAGG + Intronic
981766012 4:148250949-148250971 TTTTTTTTGGGGGGGAGTGGGGG + Intronic
981787134 4:148492076-148492098 TTTTTTTTGGGGGGGGGTGGGGG + Intergenic
981845842 4:149167826-149167848 ATTTTCTAGGTGAGGGTTTGGGG + Intergenic
982239032 4:153280076-153280098 TTTTTTTGGGGGGTGGGTGGGGG - Intronic
982291366 4:153786130-153786152 TTTTTGGGGGGGAGGGGTGGTGG + Intronic
982348622 4:154389740-154389762 TGTTTTTCGAGGAGGGGTGGGGG - Intronic
982767721 4:159367432-159367454 TTTTTTTAGGGCAGGGTGGGTGG - Intergenic
983066002 4:163211113-163211135 TTCTTTTAGGGCAGGCCTGGTGG + Intergenic
983963999 4:173787858-173787880 CTCTTTTAGGGCAGGCTTGGTGG - Intergenic
984168440 4:176332059-176332081 TTTTTGTGGGGGTGGGATGGGGG + Exonic
984368282 4:178827449-178827471 CTTTTTTGGGGGTGGGGTGGGGG - Intergenic
984438472 4:179734646-179734668 TTTTTTTTGGGGGGGGTGGGGGG + Intergenic
984839630 4:184056493-184056515 TTTTTTTTGATGATGGTTGGGGG - Intergenic
985125376 4:186688647-186688669 TTTTTTTGGGGGGGGGCGGGGGG - Intronic
985270507 4:188190251-188190273 TTTTTTTTTAGGAGGGGTGGGGG - Intergenic
985404352 4:189622698-189622720 CATGTTTAGGGGAGGGTTGTTGG - Intergenic
986348485 5:6855860-6855882 TTTTTTTGGTGGAGGGTGAGTGG + Intergenic
986831518 5:11584419-11584441 TTTTTTTGGGGGGGGGGAGGAGG + Intronic
987362462 5:17119836-17119858 TTTTTTCGGGGGGGGGATGGAGG - Intronic
987386643 5:17336358-17336380 TTTTTTTGGTGGGGGGATGGTGG + Intergenic
987682735 5:21158988-21159010 TTATTTTGGTGGAGGGTCGGGGG - Intergenic
988170041 5:27641690-27641712 TTTTTGTGGGGGCGGGGTGGGGG - Intergenic
988527429 5:31999249-31999271 TTTTTTTTGGGGGGGGCGGGTGG + Intronic
988559188 5:32264957-32264979 TTTTTTTTGGTGGGGTTTGGAGG - Intronic
988827027 5:34948034-34948056 TTTTTTTGGGGGAGGGGTCAAGG - Intronic
988948787 5:36236656-36236678 TTTTTTTAGTGGAAGTATGGGGG + Intronic
989059588 5:37397146-37397168 GTTTTTTGCGGGGGGGTTGGGGG - Intronic
989128453 5:38079659-38079681 TTTATGTGGTGGAGGGTTGGGGG + Intergenic
989467452 5:41773616-41773638 TTTTTTTGGCAGAGGGGTGGGGG - Intronic
989824447 5:45836997-45837019 CTTTTTTAGGGCAGGCCTGGTGG + Intergenic
989942704 5:50172969-50172991 CTCTTTTAGGGCAGGGCTGGTGG + Intergenic
989972637 5:50543025-50543047 CTCTTTTAGGGCAGGGCTGGTGG - Intergenic
989989029 5:50739380-50739402 TTTTTTTTGTGGGGGGATGGGGG + Intronic
990759944 5:59117814-59117836 TTTTTTTTTGTGAGGGGTGGTGG + Intronic
991062421 5:62392494-62392516 TTTTTTTAGGGGATTTTTTGTGG - Intronic
991089100 5:62676977-62676999 CTTTTTTAGGGCAGGCCTGGTGG + Intergenic
991389099 5:66123323-66123345 TTTCTTTGGGGGGGTGTTGGGGG - Intergenic
991448893 5:66730852-66730874 TTTTTTTGGGGGAGGGGGAGGGG - Intronic
991916229 5:71608745-71608767 CTTTTTTAGGGCAGGCCTGGTGG + Intronic
992161833 5:74011854-74011876 TTTTTTTTGGTGGGGGTAGGGGG + Intergenic
992302615 5:75399692-75399714 TTATTTAAGGGGAAAGTTGGGGG - Intronic
992354743 5:75969140-75969162 CTTTTTTAGGGCAGGCCTGGTGG - Intergenic
992590707 5:78293704-78293726 TGTTTTGGGGGGTGGGTTGGTGG - Intronic
993036093 5:82759368-82759390 TTTTTTTAGGGGAGAAGTGTGGG + Intergenic
993074508 5:83211616-83211638 TTTTGTTGGGGGAGGGGCGGTGG - Intronic
993092442 5:83442580-83442602 TTTTTTGAGGGGGTTGTTGGAGG + Intergenic
993452450 5:88089680-88089702 TTTTTGTAAGGGGGGGTTAGGGG - Intergenic
993610116 5:90043709-90043731 TTCTTTTAGGGCAGGCCTGGTGG + Intergenic
993974028 5:94455183-94455205 TTTTTTTGGCGGGGGGTTGGGGG - Intronic
994060139 5:95466468-95466490 TTTTCTTAGGTGTGGGTTGAGGG - Intronic
994475268 5:100260405-100260427 TTTGGTAAGGGGAGGGGTGGGGG + Intergenic
994806155 5:104450556-104450578 CTCTTTTAGGGCAGGCTTGGTGG + Intergenic
994850187 5:105044909-105044931 TTTTTTTTTGGGGGGGTGGGGGG + Intergenic
995082383 5:108068452-108068474 TTTTTTTGGGGGGGGGGCGGGGG + Intronic
995184443 5:109256828-109256850 TTTTTTTGGGGGTGGGGTGCAGG + Intergenic
995202840 5:109445793-109445815 TTCTTTTAGGGCAGGCCTGGTGG + Intergenic
995352080 5:111190164-111190186 TTTTTTTATGGTAGGGGTTGGGG - Intergenic
995642202 5:114269503-114269525 TTTTTTTGGTGCTGGGTTGGGGG + Intergenic
995806402 5:116057244-116057266 CTTTTTGAGGGGAGGGTAGAGGG + Intronic
995841156 5:116444630-116444652 TGTTTTTAGGGGATGGGAGGTGG - Exonic
996034369 5:118741475-118741497 TTTTTTGGGGGGGGGGTTTGGGG + Intergenic
996301009 5:121985798-121985820 TTATTTTTGTGGGGGGTTGGGGG + Intronic
996380852 5:122861337-122861359 TCTTTTTTTGGGAGGGGTGGTGG - Intronic
996420245 5:123255094-123255116 TTCTTTTAGGGCAGGCCTGGTGG + Intergenic
996498891 5:124194125-124194147 ATTTTTCAGGGCAGGGTTAGGGG - Intergenic
996914342 5:128694226-128694248 TTTTTTTGGGGGTGGGTCAGTGG + Intronic
997083368 5:130766744-130766766 TTCTTCTAAGGGTGGGTTGGCGG + Intergenic
997129836 5:131264913-131264935 CTTTTTTAGGGGAATTTTGGGGG + Intronic
997199462 5:132001009-132001031 TTTTAATCGGGGTGGGTTGGGGG - Intronic
997345145 5:133184898-133184920 CTCTTTTAGGGGAGGCCTGGTGG + Intergenic
997578468 5:135002139-135002161 CTCTTTTAGGGGAGGCCTGGTGG + Intronic
997680833 5:135749582-135749604 TTTTTTTTGGGGTGGGGTGGTGG + Intergenic
997732026 5:136188711-136188733 TTTTTGTTGGTGGGGGTTGGGGG - Intronic
997995052 5:138578509-138578531 TTTTTTTTGGGGGGGGGGGGGGG - Intergenic
998048362 5:139009639-139009661 CTCTTTTAGGGGAGGTCTGGTGG + Intronic
998240046 5:140433048-140433070 TTTTTTTGGGGGGGGGAAGGGGG - Intronic
998246044 5:140506306-140506328 TTTTTTTTGGCGGGGGTTTGTGG + Intronic
998349558 5:141491938-141491960 TTTTTTGAGTGTAGGGGTGGGGG - Intronic
998611652 5:143695549-143695571 TTTTTTTTGGGGGGGGTCGGGGG + Intergenic
998763355 5:145456640-145456662 TATTGTTAGGGGAGAGGTGGTGG - Intergenic
999034343 5:148330682-148330704 TTCTTTTAGGGCAGGCCTGGTGG + Intronic
999088724 5:148916046-148916068 TTTTTGGATGGGAGGGGTGGTGG - Intergenic
999704527 5:154260219-154260241 GGTTTTTTTGGGAGGGTTGGGGG - Intronic
999860677 5:155642469-155642491 TTTTTTTTGGGGGGGGGGGGAGG - Intergenic
999978201 5:156933451-156933473 TTTTTTTGGGGGGGGGTTGGGGG - Intronic
1000078563 5:157820409-157820431 TTTTTTTGGGGGAGGGGAGTGGG - Intronic
1000132260 5:158310915-158310937 TTTTTTTTGGCGGGGGCTGGGGG - Intergenic
1000513043 5:162207335-162207357 CTTTTTTTGGGGGGAGTTGGGGG + Intergenic
1000811173 5:165863674-165863696 TTTTTTTTTGGGGGGGTGGGGGG + Intergenic
1000896188 5:166858440-166858462 TTTTTTTTGGGGGGGGCGGGGGG - Intergenic
1001073036 5:168603507-168603529 TTTTTTTGGGTGGGGGGTGGTGG + Intergenic
1001376203 5:171261076-171261098 TTTTTTTTGGGGGGGGTGGGGGG - Intronic
1001376204 5:171261077-171261099 TTTTTTTTTGGGGGGGGTGGGGG - Intronic
1001466280 5:171969265-171969287 TTTTTTTTGGGGGGTGATGGGGG - Intronic
1001737480 5:174018563-174018585 CTCTTTTAGGGCAGGCTTGGTGG + Intergenic
1001964846 5:175902971-175902993 TTTTTTTTGGCAAGGGGTGGGGG - Intergenic
1003633404 6:7809102-7809124 TTTTTTTGGGGGGGGGTGGGGGG - Intronic
1003633405 6:7809103-7809125 TTTTTTTTGGGGGGGGGTGGGGG - Intronic
1003838040 6:10092541-10092563 TTTTTTTTGGGGGGGGTAGGGGG + Intronic
1004016416 6:11735952-11735974 TTTTTTTTGGCGGGGGTGGGGGG + Intronic
1004147131 6:13078152-13078174 TTTTTTTTGGGGGGAGTGGGTGG + Intronic
1004245079 6:13966767-13966789 TTTTTTTGGTGGGGGGGTGGGGG - Intronic
1004321923 6:14638602-14638624 TTTTTGGAGGGTGGGGTTGGAGG + Intergenic
1004592088 6:17061631-17061653 TATTTTTAGGCCAGGCTTGGGGG + Intergenic
1004634336 6:17452594-17452616 ATTTATTTGGGGATGGTTGGAGG - Intronic
1004654279 6:17643471-17643493 TTTTTGGTGGGGATGGTTGGGGG - Intronic
1004992559 6:21154987-21155009 TTTTTTTTTGGGGGGGGTGGGGG - Intronic
1005261810 6:24069266-24069288 ATTTTTTTGGGGAGGGGTTGTGG - Intergenic
1005327809 6:24720015-24720037 TTTTTTGGGGGGAGGGTGGGTGG - Exonic
1005341193 6:24845340-24845362 ATCTTTTAGGGGAGGGATGAAGG + Intronic
1005370283 6:25124907-25124929 TATTTTTAGGAGAGAGTTGGAGG - Intergenic
1005523200 6:26618711-26618733 TTTTTTTGGGTGGGGGGTGGAGG - Intergenic
1005712437 6:28515126-28515148 TTTTTCTAGGGGTGTGGTGGTGG + Intronic
1005949879 6:30624082-30624104 TTTTTTTGGGGGGGTGTGGGTGG + Intronic
1006206146 6:32344855-32344877 TTTTTTTGGGGCTGGGGTGGGGG + Intronic
1006635750 6:35460108-35460130 TTTTTTTTGGCGGGGGGTGGGGG + Intronic
1006635751 6:35460109-35460131 TTTTTTTGGCGGGGGGTGGGGGG + Intronic
1006708339 6:36042489-36042511 TTTTTTTTTGGCTGGGTTGGGGG + Intronic
1007296159 6:40822819-40822841 TTATTTAAGGGGAGGGATCGAGG + Intergenic
1007491691 6:42228147-42228169 TTGTTTTTGTGGGGGGTTGGGGG - Exonic
1007590535 6:43018066-43018088 GGTTTTGAGGGGAGGGATGGAGG + Intronic
1008369840 6:50719731-50719753 TTTCTTTAAGGGAAGGTGGGAGG + Intronic
1008529844 6:52446737-52446759 TTCTTTTAGGGCAGGCCTGGTGG + Intronic
1008642551 6:53479504-53479526 TTTTTTTTGGGGGTGGGTGGGGG + Intergenic
1009282619 6:61771151-61771173 TTCTTTTAGGGCAGGCCTGGTGG - Intronic
1009585640 6:65598232-65598254 TTTTTTGGGGGGGGGGTGGGTGG - Intronic
1009857970 6:69288962-69288984 TTGGGTTGGGGGAGGGTTGGGGG - Intronic
1009905782 6:69868111-69868133 TCCTTTTTGGGGAGGGGTGGTGG - Intronic
1009975340 6:70666009-70666031 TTTTTTGGGGGGGGGGTGGGTGG + Intergenic
1010032582 6:71286884-71286906 TTTTTTTTGGCGGGGGGTGGGGG + Intergenic
1010052175 6:71518680-71518702 TTTTTTTGGGGGCGGGGAGGGGG - Intergenic
1010320507 6:74503849-74503871 TATTTTGAGGGGGGTGTTGGGGG + Intergenic
1010383668 6:75253105-75253127 TATTTTGAGGGGAGGGTGGAGGG - Exonic
1010638516 6:78290714-78290736 TTTCTTTAGGGAAGGGATAGAGG + Intergenic
1010639029 6:78299465-78299487 CTTTTTTTGGGATGGGTTGGCGG - Intergenic
1010703013 6:79075571-79075593 ATTTTTGGGGGGAGGGTGGGGGG - Intronic
1010781557 6:79950952-79950974 TTTTTTTAGGGGTGGAGAGGTGG + Intergenic
1011130536 6:84047477-84047499 TTTTTTTAGGCTAGGCTTGGTGG - Intronic
1011184660 6:84660961-84660983 ATTTTTGAGAGGAGGGTGGGAGG + Intergenic
1011244620 6:85308994-85309016 CTCTTTTAGGGGAGGCCTGGTGG - Intergenic
1011479358 6:87778894-87778916 TTTTTTTTGGGGGGGGGTGGTGG + Intergenic
1011570896 6:88733362-88733384 TTTTTTTGGAGGGGGGGTGGGGG - Intronic
1011623973 6:89268643-89268665 TTTTTTTGGGGGACGGGGGGGGG + Intronic
1011764532 6:90605805-90605827 TTTTTTTGGGGGGGGGGAGGAGG + Intergenic
1011929912 6:92699169-92699191 TCTTTTTTTGGGGGGGTTGGGGG - Intergenic
1012576484 6:100807293-100807315 TTTTTTGAGGGGAGGGAGGGTGG - Intronic
1012603269 6:101125614-101125636 TTTTTTTAGAGGTGGGTGGTCGG + Intergenic
1012641243 6:101618692-101618714 TTGTTTTAGTGGAGGCTTGTTGG + Intronic
1012868820 6:104649324-104649346 TTTTTTTAGGCCAGGTATGGTGG + Intergenic
1012945752 6:105463853-105463875 TTTTTTTGGTGGGGGGATGGGGG - Intergenic
1013509989 6:110835864-110835886 TTTTTTGGGGGGTGGGGTGGGGG - Intronic
1013613013 6:111812625-111812647 TTTTTTTAAGGGAGGGAGGTTGG + Intronic
1013755727 6:113459405-113459427 TTTTTTGGGGGGGGGGTTGGGGG - Intergenic
1013755728 6:113459406-113459428 TTTTTTTGGGGGGGGGGTTGGGG - Intergenic
1013762366 6:113532946-113532968 TTCTTTTAGGGCAGGCCTGGTGG - Intergenic
1013997052 6:116321344-116321366 TTTTTTTTTGGTAGGGATGGGGG + Intronic
1013999998 6:116354431-116354453 TTATTTTAAGGGAGAGTGGGTGG + Intronic
1014184071 6:118415486-118415508 TTCTTTTCGTGGATGGTTGGGGG + Intergenic
1014195337 6:118551316-118551338 TTTTTTTGTGCGGGGGTTGGGGG - Intronic
1014383821 6:120777522-120777544 TTTTTTTAAGGCCGGGCTGGTGG + Intergenic
1015191569 6:130477467-130477489 CTCTTTTAGGGGAGGCCTGGTGG - Intergenic
1015425117 6:133056147-133056169 TTTTTCTTGGAGGGGGTTGGTGG + Intergenic
1015618834 6:135108029-135108051 TTTTTTTGGGAGGGGGGTGGGGG + Intergenic
1015631193 6:135233370-135233392 GTTTTGTGGGGGAGGGTTTGGGG + Intergenic
1015691212 6:135926078-135926100 TTTTTTTTGGGGGGGGGGGGGGG + Intronic
1016208622 6:141501616-141501638 CTTTTTTTGGGGGGGGTAGGGGG - Intergenic
1016584094 6:145663979-145664001 CTCTTTTAGGGCAGGCTTGGTGG - Intronic
1016829930 6:148424237-148424259 TTTTTTTTGGGGGGGGGAGGTGG + Intronic
1017076637 6:150624901-150624923 TTTTTTTAGGCCAGGCGTGGTGG + Intronic
1017130880 6:151107409-151107431 TCTTTTTTGGGGGGTGTTGGGGG + Intergenic
1017267691 6:152469082-152469104 CTTTTTTGGGGGAGTGTGGGGGG + Intronic
1017317162 6:153044684-153044706 TTTATTTAACGGAGAGTTGGGGG + Intronic
1017342775 6:153345310-153345332 TTTTGGTGGGGGTGGGTTGGGGG + Intergenic
1017401276 6:154066511-154066533 TTTTTTTTGGGGGGGATGGGAGG - Intronic
1017436635 6:154421727-154421749 CTTTACCAGGGGAGGGTTGGGGG - Intronic
1017471280 6:154739162-154739184 TTTTTGTAGGGAAGGGTGGGGGG + Intronic
1017524908 6:155233996-155234018 TTTTTTTTGGGGGGGGGTTGGGG + Intronic
1018205869 6:161436454-161436476 CTTTTTTGGGGGGGGGTGGGCGG + Intronic
1018583671 6:165332936-165332958 CTTTTTTTGGGGGGGGTGGGGGG - Exonic
1019091553 6:169539500-169539522 TTTTTTTAAGTAAGGGATGGTGG - Intronic
1019753116 7:2745484-2745506 TTCTTTTAGGGCAGGCCTGGTGG - Intronic
1019888787 7:3928623-3928645 TTTTTTTTGGGGGGGGTGGGTGG + Intronic
1019928187 7:4206746-4206768 TTTATTTAGGAGAAGGATGGGGG - Intronic
1020200978 7:6079912-6079934 TTTTTTTTGGGGGGCGTAGGGGG - Intergenic
1020265800 7:6559237-6559259 TTTTTTTGGCGGGGGGTGGGGGG - Intergenic
1020964681 7:14850005-14850027 TGTTTTTAGGGGATGGGTTGAGG - Intronic
1021134704 7:16951209-16951231 TTTTTTTTGGGGGGGGCGGGTGG - Intergenic
1021330163 7:19327364-19327386 TTTTATTATTGAAGGGTTGGTGG + Intergenic
1021476955 7:21073143-21073165 TTTTTGAAGAGGAGGGTTGCAGG + Intergenic
1021542158 7:21771835-21771857 TTTTTTGTGGGGGGCGTTGGGGG - Intronic
1021584930 7:22197887-22197909 TTTTTTTGGGGGGGGGTGGTAGG + Intronic
1021802893 7:24325578-24325600 CTTTTTTGGGGGTGGGTGGGTGG - Intergenic
1021969489 7:25951864-25951886 TTTTATTTGGGGATGGGTGGTGG - Intergenic
1022072614 7:26932065-26932087 TTTTTGTAGGGCAGGCCTGGTGG - Intronic
1022237404 7:28475281-28475303 TTTTTTTAGGCTAGGCGTGGTGG + Intronic
1022479777 7:30735153-30735175 TTTTTTTTTGGTAGAGTTGGGGG - Intronic
1022684606 7:32584768-32584790 TTTTTTTTGGGGGGGGGGGGGGG + Exonic
1022684607 7:32584769-32584791 TTTTTTTGGGGGGGGGGGGGGGG + Exonic
1022841997 7:34173742-34173764 TTCTTTTAGGGCAGGCCTGGTGG + Intergenic
1023323807 7:39030845-39030867 TTTTTTTTGGGGGGGGCAGGAGG - Intronic
1023380079 7:39598423-39598445 TTTTTTTAAGGAAGTGTTGATGG + Intronic
1023583229 7:41703940-41703962 TTTTTGTGGGGGAGGGGTGTTGG + Intergenic
1023673287 7:42602813-42602835 CTCTTTTTGGGGAGGGTTGGGGG - Intergenic
1023792556 7:43764763-43764785 TTTTTTTTGCGGGGGGTGGGGGG - Intronic
1023827614 7:44019953-44019975 TTTTTTTTGGAGATGGTTGTGGG + Intergenic
1023936777 7:44746175-44746197 TTTTTTTGGGGGGGTGATGGTGG + Intergenic
1023948028 7:44819114-44819136 TTTTTTGCGGGCAGGGTGGGCGG - Intronic
1024128559 7:46326159-46326181 TTTTTTTTGGGGGGGGTGGGGGG - Intergenic
1024128560 7:46326160-46326182 TTTTTTTTTGGGGGGGGTGGGGG - Intergenic
1024406055 7:48981936-48981958 TTCATTTGGGGGAGGGTGGGGGG + Intergenic
1024534284 7:50417263-50417285 TTTTTTCAGTGGAGGGGTGCTGG + Intergenic
1024734343 7:52288252-52288274 TTTTTTTTGGGGTGGGGTGGGGG + Intergenic
1024784217 7:52887349-52887371 TTTTTTTTGGAGGGGGTAGGTGG - Intergenic
1024877729 7:54045488-54045510 TTCTTTTAGGGCAGGCCTGGTGG + Intergenic
1025068270 7:55875836-55875858 TTTCTTTGGGGGAGTGTTGGGGG + Intergenic
1025097927 7:56111699-56111721 TTTTTTTTGGCCAGGGGTGGTGG + Intergenic
1025114744 7:56248061-56248083 GTTTTTGAGGGATGGGTTGGTGG - Intergenic
1026238601 7:68551739-68551761 TTTTTTGGGGGGGGGGTGGGTGG - Intergenic
1026403663 7:70042171-70042193 TTTTTTTGGGGGGTGGGTGGGGG - Intronic
1026554896 7:71399232-71399254 TTTTTTTGGAGGAGGGCAGGGGG - Intronic
1026667638 7:72357500-72357522 TTTGATTAGGGATGGGTTGGGGG - Intronic
1026702999 7:72664065-72664087 TGCTTTGAGGGGAGGGTTGTTGG - Intronic
1026959533 7:74399536-74399558 TTTTTTTGGGGGGGGGGGGGTGG + Intronic
1027741733 7:82016608-82016630 TTTTTTTTGGGGGGGGGGGGCGG - Intronic
1027753119 7:82177080-82177102 TTTTTTTTGGCGGGGGTTGGGGG + Intronic
1027923540 7:84429638-84429660 TATTTTTAGGGGAAGGGTGTAGG - Intronic
1028101258 7:86823768-86823790 TCTTTTTAAGGGAGGGTGGTGGG - Intronic
1028506821 7:91580130-91580152 TTTTTTTTTGGGGGGGTGGGGGG + Intergenic
1028762107 7:94508807-94508829 TTTTTTTTGGCTAGGCTTGGTGG + Intergenic
1029478954 7:100801588-100801610 TTTTTGTAGAGACGGGTTGGGGG - Intergenic
1029989293 7:104948321-104948343 TCTTCTTGGTGGAGGGTTGGAGG + Intergenic
1029993850 7:104987170-104987192 TTTTTTTTGGGGGGCGGTGGAGG + Intergenic
1030059174 7:105609452-105609474 TTTTTTTAGGCCAGGCATGGTGG - Intronic
1032109164 7:129060679-129060701 TTTTTTTGGCGGGGGGTCGGGGG - Intergenic
1032123286 7:129172255-129172277 TATTTTTGGGGGTGGGGTGGGGG - Intergenic
1032229049 7:130058385-130058407 TTTTTCTAGGCTAGGCTTGGTGG - Intergenic
1032337263 7:131037091-131037113 TTTTTGTAGGGGCGGGGGGGGGG - Intergenic
1032595837 7:133238997-133239019 TTTTTTTGGGGGGGGGTGGGGGG - Intergenic
1032595838 7:133238998-133239020 CTTTTTTTGGGGGGGGGTGGGGG - Intergenic
1032810172 7:135406298-135406320 TTTTTGGGGGGGAGGGTGGGGGG - Intronic
1033114064 7:138609711-138609733 TTTTTTTTTGGGGGGGGTGGGGG + Intronic
1033146276 7:138872901-138872923 CTTTTTTTGGCGGGGGTTGGGGG - Intronic
1033150523 7:138910846-138910868 TTTTTTTAGGCCAGGTATGGTGG - Intronic
1033338296 7:140471841-140471863 TTTGTTCAGGGGTGGGTTGGAGG - Intronic
1033375861 7:140761353-140761375 TTCTTTTAGGGCAGGCCTGGGGG - Intronic
1033624012 7:143090231-143090253 TTCTTTTAGGGCAGGCCTGGTGG - Intergenic
1033856085 7:145562732-145562754 CTCTTTTAGGGCAGGCTTGGTGG - Intergenic
1033873210 7:145783422-145783444 TTTTTTTTCTGGGGGGTTGGGGG - Intergenic
1033960542 7:146907615-146907637 CTCTTTTAGGGCAGGCTTGGTGG - Intronic
1034216775 7:149413668-149413690 TTTTTTTATTTTAGGGTTGGGGG - Intergenic
1034231392 7:149531450-149531472 CTTTTTTTGGGGGGGGTGGGGGG - Intergenic
1034308296 7:150064387-150064409 TATTTTTAGCGGGGGGTTGGGGG - Intergenic
1034372081 7:150607548-150607570 TTCTTTTAGGGCAGGCCTGGTGG - Intergenic
1034379718 7:150680364-150680386 TTCTTTTAGGGCAGGCCTGGTGG - Intergenic
1034634267 7:152554831-152554853 AATTTTTAGGCCAGGGTTGGTGG - Intergenic
1034798557 7:154036284-154036306 TATTTTTAGCGGGGGGTTGGGGG + Intronic
1034836471 7:154356565-154356587 TTTTTTGGTGGGGGGGTTGGGGG - Intronic
1035141356 7:156765766-156765788 ATTTCTTAGGGGCTGGTTGGAGG - Intronic
1035850357 8:2913957-2913979 TTTTTTTTGGGGGGGGCGGGTGG + Intergenic
1035921294 8:3678999-3679021 GTCTTTTAGGGGAGGTCTGGTGG - Intronic
1035973788 8:4284372-4284394 CTCTTTTTGGGGAGGGTGGGTGG - Intronic
1036164566 8:6420526-6420548 TTTTTTTCGGGGAGGGAATGGGG + Intronic
1036187493 8:6636792-6636814 TTTTTTTGGGGGGTGGTGGGTGG - Intronic
1036238297 8:7061427-7061449 TTTTTTTTTGGGGGGGGTGGGGG - Intergenic
1036485816 8:9177870-9177892 TTTTGTAAAGGGAGGGTTGCAGG + Intergenic
1036524481 8:9522000-9522022 TTTTTTTTGGGGGGGGTTGGAGG + Intergenic
1036643124 8:10596390-10596412 TTTTTTGGGGGGAGGGGTGCGGG - Intergenic
1036723307 8:11198904-11198926 TTTTTTTGGGCGGGGGCTGGGGG - Intronic
1036767148 8:11556347-11556369 ATTATGTAGGGGAGGGGTGGGGG + Intronic
1036862217 8:12362771-12362793 TTTTTTTTGTGGGGGGTGGGGGG + Intergenic
1037412599 8:18614334-18614356 TTTTTTTGGGGGGGGGATGGGGG - Intronic
1037452971 8:19035751-19035773 TTTTTTTGGGGGGGGTGTGGGGG + Intronic
1038641844 8:29335212-29335234 TTTTCTGTGGGGAGGGTTTGGGG - Exonic
1038678488 8:29645014-29645036 TTTTTTTGGGGGGGGGGTGCGGG - Intergenic
1038728907 8:30109028-30109050 TTTTTTTCGGGGCGGGGGGGTGG - Intronic
1038874546 8:31533514-31533536 TTATTTTAGTGGAGTTTTGGAGG + Intergenic
1038915303 8:32014709-32014731 CTTTTTTGGGGGGGGGTTGGGGG - Intronic
1040130193 8:43786608-43786630 TTTTTTTTGGGGGGGGAGGGGGG - Intergenic
1040357327 8:46631884-46631906 CTTTTTTAGGGCAGGCCTGGTGG + Intergenic
1040431562 8:47348124-47348146 TTCTTTTAGGGCAGGCCTGGTGG + Intronic
1041595621 8:59647479-59647501 TTTTTTTTTGGGGGGGGTGGGGG + Intergenic
1041595622 8:59647480-59647502 TTTTTTTTGGGGGGGGTGGGGGG + Intergenic
1042115650 8:65428305-65428327 CTCTTTTAGGGCAGGGCTGGTGG - Intergenic
1042186713 8:66142994-66143016 TTTCTTTTTTGGAGGGTTGGTGG + Intronic
1042211542 8:66386136-66386158 CTTTTTTTGGTGGGGGTTGGGGG + Intergenic
1042861426 8:73317917-73317939 TTTTTTTTGGGCGGGGGTGGGGG - Intronic
1043056312 8:75444243-75444265 CTCTTTTAGGGCAGGCTTGGTGG - Intronic
1043383883 8:79730309-79730331 GTTGTTTGGGGGAGGTTTGGTGG - Intergenic
1043464164 8:80487849-80487871 TTTTTTTCGGGGGTGGGTGGGGG - Intronic
1043664525 8:82791586-82791608 TTTTTTTTGGCGGGGGTTGGCGG - Intergenic
1043757253 8:84019050-84019072 TTCTTTTAGGGCAGGCCTGGTGG + Intergenic
1044163189 8:88946915-88946937 TTTTTTTGTGGGCTGGTTGGAGG - Intergenic
1044183168 8:89220141-89220163 CTCTTTTAGGGGAGGCCTGGTGG - Intergenic
1044378310 8:91502156-91502178 TTTTTTTCGGCGGGGGTGGGAGG + Intergenic
1044432632 8:92126638-92126660 TTTTTTTGGTGGGGGGGTGGGGG - Intergenic
1044698428 8:94945958-94945980 TTTTTTAAAGGGAGGGATGGAGG - Intronic
1044702926 8:94980619-94980641 TTTTTTTAGTAGGGGGGTGGGGG + Intronic
1044740322 8:95319882-95319904 TTTTTTTGGTGGGGGGATGGAGG - Intergenic
1044746811 8:95378605-95378627 TTTTTTTGGGGGGGGGATTGGGG + Intergenic
1044746812 8:95378606-95378628 TTTTTTGGGGGGGGGATTGGGGG + Intergenic
1045032885 8:98154318-98154340 TGTTTGTAGGGGAGGGACGGTGG + Intronic
1045308637 8:100981313-100981335 ATTTTGTGGGGGAGGGTGGGTGG - Intergenic
1045974595 8:108116932-108116954 TCTTTTTAGTTGAGGGTAGGAGG + Intergenic
1045997904 8:108384822-108384844 TTTTTTTAGGGGGGATTTGTGGG - Intronic
1046172283 8:110526201-110526223 TTTTTTTGGGGGGGGGGGGGTGG - Intergenic
1046280403 8:112021969-112021991 TTTTTTTTTGGGGGGGGTGGGGG - Intergenic
1046521694 8:115333475-115333497 TTTTTTTTGGGGGGGGTGGTGGG - Intergenic
1046583535 8:116123049-116123071 TTTTTTTTGCGGGGGGGTGGGGG + Intergenic
1046809079 8:118513464-118513486 TTTTTCTTTGGGAGGGTAGGTGG - Intronic
1047224432 8:122944420-122944442 ATTTTGTAGGGCAGGGTTGGGGG - Intronic
1047989113 8:130267024-130267046 TTTTTTGAGGGGGTGGGTGGCGG - Intronic
1047993380 8:130310131-130310153 TTTTTTTTGGGGGGGGGAGGGGG + Intronic
1047993381 8:130310132-130310154 TTTTTTTGGGGGGGGGAGGGGGG + Intronic
1048198647 8:132353233-132353255 TTTTTTTGGCGGAGGGCTGGGGG - Intronic
1048209844 8:132445660-132445682 GTTTTTTTGGGGTGGGTGGGTGG - Intronic
1048352605 8:133628081-133628103 TTTTTTTCGGGGGGTGGTGGGGG + Intergenic
1048431518 8:134375761-134375783 TTTTATTAGGGGATGCTTTGGGG - Intergenic
1048884439 8:138898414-138898436 TATTTTTTGGGGAGTGGTGGCGG - Intronic
1050015215 9:1225699-1225721 CTCTTTTAGGGCAGGCTTGGTGG - Intergenic
1050154859 9:2655704-2655726 TTTTTTCATGGGAGGTTTGGAGG + Exonic
1050161463 9:2724014-2724036 TTTTTTTTGCCGGGGGTTGGGGG + Intronic
1050310482 9:4347737-4347759 TTTTTTTTGGTGGGGGTTGGGGG + Intronic
1050462330 9:5887254-5887276 TTTTTTGGTGGGTGGGTTGGGGG - Intronic
1050596423 9:7208978-7209000 TTTTTTTTGGAGGGGGGTGGTGG + Intergenic
1050841337 9:10152820-10152842 TCTTTTTGGGGGAGGGTAGGGGG - Intronic
1050911272 9:11074569-11074591 TCTTTGTATGAGAGGGTTGGGGG - Intergenic
1050923617 9:11235685-11235707 TTTCTATAGGGGAGGGGTTGGGG + Intergenic
1051010789 9:12411219-12411241 TTTTTTGTGGGGGGTGTTGGGGG - Intergenic
1051039445 9:12789075-12789097 TTTTTTTGGGGGGGTGCTGGGGG - Intronic
1051041783 9:12820500-12820522 TTTTTTTTGGGGGGGGGGGGGGG - Intronic
1051312799 9:15794466-15794488 TTTTTTTGGTGGGGGGGTGGGGG - Intronic
1051632911 9:19156742-19156764 TTTTTTTTCGGGGGGGTGGGGGG - Intergenic
1051800023 9:20922267-20922289 TTTATAATGGGGAGGGTTGGAGG - Intronic
1052002684 9:23306000-23306022 TTTTTTCAGGGGATGGGTGGTGG + Intergenic
1052528124 9:29647729-29647751 TTTTTTTTGGGGTGGGGGGGTGG + Intergenic
1052594587 9:30541272-30541294 CTCTTTTAGGGCAGGGCTGGTGG - Intergenic
1052759999 9:32580579-32580601 TTTTTTTGGTGGGGGGTGGGGGG - Intergenic
1052760000 9:32580580-32580602 TTTTTTTTGGTGGGGGGTGGGGG - Intergenic
1052883731 9:33623372-33623394 TATTTTGGGCGGAGGGTTGGGGG + Intergenic
1053328399 9:37178394-37178416 TTTTTTTGGTGGGGGGTAGGGGG - Intronic
1053409548 9:37906674-37906696 TTTTTTGAGGGGAGGAGTGGAGG - Intronic
1053504633 9:38631163-38631185 TTTTTTTTGGGGGGGGATGGGGG + Intergenic
1053504634 9:38631164-38631186 TTTTTTTGGGGGGGGATGGGGGG + Intergenic
1053534164 9:38909645-38909667 TTTTTTTAAATGGGGGTTGGTGG - Intergenic
1054206388 9:62134064-62134086 TTTTTTTAAATGGGGGTTGGTGG - Intergenic
1054631970 9:67454282-67454304 TTTTTTTAAATGGGGGTTGGTGG + Intergenic
1054705400 9:68456301-68456323 TTTTTTTGGGGGTGGGGGGGTGG + Intronic
1054892205 9:70262945-70262967 TTTTTTTTGGCGGGGGTAGGCGG - Intronic
1054892627 9:70268448-70268470 TTTTTTTTGGGGGGGGCAGGGGG - Intronic
1055400725 9:75920950-75920972 TTTTTTGAGGGGAGAGTTTTTGG + Intronic
1055554341 9:77460045-77460067 TTTTCTGATGGGAGGTTTGGAGG - Intronic
1055860643 9:80745843-80745865 CTCTTTTAGGGCAGGCTTGGTGG + Intergenic
1055899599 9:81219111-81219133 CTCTTTTAGGGCAGGCTTGGTGG - Intergenic
1056786961 9:89600140-89600162 TTTGTGTAGGGGAGAGTTGGTGG - Intergenic
1057256516 9:93552972-93552994 TTTTCTGATGGGAGGTTTGGTGG + Intronic
1057357515 9:94344109-94344131 TTTTTTTGGCGGGGGGTTGGAGG - Intergenic
1057399317 9:94708818-94708840 TATTTTTGGGGTAGGGTTGCTGG + Intergenic
1057650239 9:96913517-96913539 TTTTTTTGGCGGGGGGTTGGAGG + Intronic
1057709028 9:97420357-97420379 TTTTTTTTGGGGGGGGCGGGTGG + Intronic
1057733491 9:97632491-97632513 TTACTCGAGGGGAGGGTTGGGGG - Intronic
1057741148 9:97712319-97712341 TTTTTGTAGAGATGGGTTGGGGG - Intergenic
1057858249 9:98619262-98619284 TTTTTCTGGGGCAGGGGTGGGGG - Intronic
1057947968 9:99346259-99346281 TCTTTGTAGGGGAAGCTTGGTGG - Intergenic
1058167224 9:101633744-101633766 TTTTTTCATGGATGGGTTGGGGG - Intronic
1058224145 9:102339170-102339192 CTCTTTTAGGGCAGGCTTGGTGG - Intergenic
1058480624 9:105390164-105390186 TTTGTTTGGGGGTGGGTTTGGGG + Exonic
1058599269 9:106652078-106652100 TATTTTTTGGGGAGGTGTGGGGG + Intergenic
1058705487 9:107634490-107634512 TTTTTTTGGGGGGGGGTGCGGGG - Intergenic
1058705488 9:107634491-107634513 TTTTTTTTGGGGGGGGGTGCGGG - Intergenic
1058852026 9:109021804-109021826 TTTTTTTGGGGGGGTGGTGGTGG - Intronic
1058968220 9:110056389-110056411 TTTTTATTTGGGTGGGTTGGAGG + Intronic
1059370555 9:113828980-113829002 TTTTTGGCGGGGAGGGGTGGGGG - Intergenic
1059555092 9:115272677-115272699 TTTTTTTTGGGGGGGGTGGATGG + Intronic
1059715069 9:116905859-116905881 TTTTTTTTGGGGGGGGGTGCGGG + Intronic
1059715070 9:116905860-116905882 TTTTTTTGGGGGGGGGTGCGGGG + Intronic
1059979598 9:119756595-119756617 TTTTTTTTGGGGGGGGGGGGTGG - Intergenic
1060071672 9:120555128-120555150 ATTTTTTTGGGGGGGGGTGGGGG + Intronic
1060071673 9:120555129-120555151 TTTTTTTGGGGGGGGGTGGGGGG + Intronic
1060140693 9:121207489-121207511 TGTTTGTAGGGCAGGCTTGGAGG - Intronic
1060441018 9:123639439-123639461 TTTTTTTGGTAGGGGGTTGGGGG - Intronic
1061019809 9:128007068-128007090 TTTTTTTTGGGGGGGGGTGGTGG + Intergenic
1061019810 9:128007069-128007091 TTTTTTTGGGGGGGGGTGGTGGG + Intergenic
1061237106 9:129349586-129349608 CTTCTTCAGGGGAGGGTGGGTGG + Intergenic
1061377736 9:130236152-130236174 GTTTTTTCGGAGGGGGTTGGTGG + Exonic
1061421601 9:130475755-130475777 TTTTTTTGGTGGGGGGGTGGGGG + Intronic
1061459750 9:130727749-130727771 TTTTTTTTGGGGGGGGGGGGCGG - Intronic
1061644381 9:131988641-131988663 TTTTTTTGCGGGGGGATTGGGGG + Intronic
1062088419 9:134661017-134661039 TTCTTTTAGGGGAGGATGGAAGG + Intronic
1185749201 X:2597161-2597183 TTGTGTTTGGGGAGGGTGGGCGG + Intergenic
1186061872 X:5717836-5717858 ATTTTTTGGGGGAGGGGGGGTGG - Intergenic
1186080864 X:5930401-5930423 TTGCTTTAGGGGAGGGTGTGAGG - Intronic
1186086625 X:5997122-5997144 TTTTTTGGGGGTGGGGTTGGAGG + Intronic
1186331686 X:8541404-8541426 TGTTTTTGGGGGGGGGGTGGTGG - Intronic
1186636992 X:11417005-11417027 TATTTTTAGTTGAGGGTTTGAGG - Intronic
1187348544 X:18489886-18489908 TTATTTTGAGGGAGAGTTGGGGG - Intronic
1187509884 X:19908174-19908196 TTTTTTTAAGAGATGGTGGGGGG - Intergenic
1187639404 X:21272437-21272459 TTTTTGTAGGGAATGATTGGTGG - Intergenic
1187715699 X:22100346-22100368 TTTTCTTAGGGGAGGGGAAGGGG + Intronic
1187838206 X:23457728-23457750 CTCTTTTATGGCAGGGTTGGTGG + Intergenic
1187891993 X:23945197-23945219 TTTTTTCAGAAGAGGGTTGGGGG - Intergenic
1188669535 X:32866717-32866739 TTTTTTTTGGGGGGGGGTGGGGG + Intronic
1188669536 X:32866718-32866740 TTTTTTTGGGGGGGGGTGGGGGG + Intronic
1189122871 X:38413843-38413865 TATTTTTAGTGGCGGGTAGGGGG + Intronic
1189152755 X:38725045-38725067 TTTTTTTTTGGGGGGGGTGGGGG + Intergenic
1189152756 X:38725046-38725068 TTTTTTTTGGGGGGGGTGGGGGG + Intergenic
1189817764 X:44841268-44841290 TTGTTTTAGGTGAGTGTTTGGGG - Intergenic
1190243317 X:48674641-48674663 GTTTTTTTGGTGGGGGTTGGTGG - Intergenic
1190295716 X:49026226-49026248 TTTTTTTTGGGGGGGGAAGGGGG - Intergenic
1190720926 X:53146932-53146954 CTCTTTTAGGGCAGGCTTGGTGG - Intergenic
1190789952 X:53689233-53689255 TTTTTTTTGGGGGGGGAGGGGGG + Intergenic
1190807464 X:53852622-53852644 TTCTTTTAGGGCAGGCCTGGTGG + Intergenic
1190811661 X:53890246-53890268 TTCTTTTAGGGCAGGCCTGGTGG - Intergenic
1190921555 X:54858114-54858136 TTCTTTTAGGGCAGGCCTGGTGG + Intergenic
1190922094 X:54863376-54863398 GTTTTTTAGGGCAGGCCTGGTGG - Intergenic
1190948072 X:55115280-55115302 ATTTTTTTGGGGGGGGTAGGGGG - Intronic
1191087542 X:56585698-56585720 TTCTTTTAGGGCAGGCCTGGTGG + Intergenic
1191125800 X:56952916-56952938 GTCTTTTAGGGGAGGCCTGGTGG + Intergenic
1191808552 X:65161943-65161965 TTCTTTTAGGGCAGGCCTGGTGG + Intergenic
1191981334 X:66929027-66929049 TTCTTTTAGGGTAGGCCTGGTGG + Intergenic
1192071421 X:67944486-67944508 CTCTTTTAGGGGAGGCCTGGTGG - Intergenic
1192136353 X:68604210-68604232 CTCTTTTAGGGGAGGCCTGGTGG - Intergenic
1192155003 X:68738201-68738223 TTCTTTTAGGGGAGGCCTGGTGG - Intergenic
1192299050 X:69881280-69881302 TTTTTTTTGGGGGGTGGTGGTGG - Intronic
1192772728 X:74209102-74209124 GTTTTTTGGGGGAGGGGTGGTGG - Intergenic
1193004545 X:76601261-76601283 CTCTTTTAGGGCAGGCTTGGTGG + Intergenic
1193009855 X:76664448-76664470 CTCTTTTAGGGCAGGCTTGGTGG + Intergenic
1193018004 X:76757525-76757547 TTCTTTTAGGGCAGGCCTGGTGG - Intergenic
1193087125 X:77456700-77456722 GTTATTTTGGGGAGGGATGGGGG + Intronic
1193189314 X:78550612-78550634 TTCTTTTAGGGCAGGCCTGGTGG - Intergenic
1193277558 X:79606811-79606833 TTCTTTTAAGGCAGGTTTGGTGG - Intergenic
1193550192 X:82883043-82883065 TTTTATTAGGGAAGGGGTGTTGG - Intergenic
1194219160 X:91170078-91170100 TTTTTTAAGGTGAGAGATGGGGG + Intergenic
1194834557 X:98665699-98665721 TTTTTTTGTGGGAGGGGGGGTGG + Intergenic
1194972928 X:100364069-100364091 TTTCTTTACGGCAGGGTTGGGGG + Intronic
1195375469 X:104223281-104223303 TTTTTTTTTGGGAGGGAGGGGGG + Intergenic
1195421067 X:104676276-104676298 CTCTTTTAGGGCAGGGCTGGTGG + Intronic
1195764689 X:108283582-108283604 TTTTTTTGGGGGGGGGTTGGCGG + Intronic
1195807999 X:108796925-108796947 TTTTTTTTGGGGGGGTGTGGGGG + Intergenic
1195808000 X:108796926-108796948 TTTTTTTGGGGGGGTGTGGGGGG + Intergenic
1195878062 X:109563085-109563107 TTTTTTGGGGGGTGGGTGGGGGG - Intergenic
1195878063 X:109563086-109563108 TTTTTTTGGGGGGTGGGTGGGGG - Intergenic
1196021921 X:110999625-110999647 TTTTATTGGGGGAGTGGTGGTGG + Intronic
1196474587 X:116068073-116068095 CTCTTTTAGGGGAGGCCTGGTGG + Intergenic
1196507117 X:116460567-116460589 TTTTTTTGGTGGGGGGCTGGGGG + Exonic
1196736951 X:118988586-118988608 TTTTTTTTTGGTAGGGTTAGAGG + Intronic
1196792352 X:119475601-119475623 TTTTTTTTTGCGGGGGTTGGGGG + Intergenic
1196851715 X:119944482-119944504 TTTTTTTTGAGGGGGGTCGGGGG + Intergenic
1197098824 X:122627362-122627384 ATCTTTTAGGGAAGAGTTGGAGG - Intergenic
1197222178 X:123924801-123924823 TTTTTTTTGGGGGGGGCAGGAGG + Intergenic
1197339047 X:125243645-125243667 TTTTTTTTTGGAAGGGTTTGGGG - Intergenic
1197438475 X:126461086-126461108 TTCTTTTAGGGCAGGCCTGGTGG - Intergenic
1197543140 X:127790729-127790751 TTCTTTTAGGGCAGGCCTGGTGG - Intergenic
1197957025 X:131962411-131962433 GTTTTTTAGGGCAGGCCTGGTGG + Intergenic
1197973015 X:132134574-132134596 CTTTTTTAGGGCAGGCCTGGTGG - Intergenic
1198006638 X:132501356-132501378 TGTTTTTATGGGAACGTTGGTGG - Intergenic
1198343008 X:135732987-135733009 TTTTTATTGGGGTGGGTGGGGGG - Intergenic
1198344981 X:135750308-135750330 TTTTTATTGGGGTGGGTGGGGGG + Intergenic
1198429321 X:136549612-136549634 TTAGTTCAGGGGAGGGGTGGTGG - Intronic
1198466645 X:136909772-136909794 TTTTGTCAGGTGAGGATTGGAGG + Intergenic
1198477997 X:137014440-137014462 TTTTTTTAAAGAAGGGTTGAAGG - Intergenic
1198638354 X:138725785-138725807 TATTTTTACAGGAGGGTTGTGGG - Intronic
1198830430 X:140744562-140744584 TTTTTTGGGGGGGGGGGTGGGGG + Intergenic
1198854691 X:141003460-141003482 TTTTTTTAGGAGCAGGTTGCGGG - Exonic
1198908010 X:141583908-141583930 TTTTTTTAGGAGCAGGTTGCGGG + Exonic
1198908781 X:141590516-141590538 TTTTTTTAGGAGCAGGTTGCGGG - Exonic
1198974898 X:142325734-142325756 TTCTTTTAGGGCAGGTCTGGTGG + Intergenic
1199022394 X:142897282-142897304 TTTTTTTGGGGGGGGGGTGGGGG + Intergenic
1199035336 X:143043492-143043514 TTTTTTTGGGGGTGGGTGGGGGG - Intergenic
1199035337 X:143043493-143043515 TTTTTTTTGGGGGTGGGTGGGGG - Intergenic
1199122427 X:144071385-144071407 TTTTTTTTTGGGGGGGGTGGTGG + Intergenic
1199369341 X:147027646-147027668 TTTTTGCGGGGGAGGGTGGGGGG + Intergenic
1199465130 X:148127647-148127669 CTTTTTTAGGGCAGGCCTGGTGG + Intergenic
1199826424 X:151504842-151504864 CTTTTTTGGGGGGGGGGTGGGGG + Intergenic
1199826425 X:151504843-151504865 TTTTTTGGGGGGGGGGTGGGGGG + Intergenic
1199834510 X:151575212-151575234 TTTTTTTTGGCGGGGGTGGGGGG + Intronic
1200051821 X:153436845-153436867 TTTTTTTAGGGGGAGGAGGGAGG - Intergenic
1200096017 X:153662738-153662760 TTTTTTGGGGGGGGGGTGGGGGG - Intergenic
1200096018 X:153662739-153662761 TTTTTTTGGGGGGGGGGTGGGGG - Intergenic
1200125857 X:153814474-153814496 TTTTTTGGGGGGGGGGTGGGGGG - Intronic
1200125858 X:153814475-153814497 TTTTTTTGGGGGGGGGGTGGGGG - Intronic
1200425800 Y:3019322-3019344 ATTTTTTAGGGCGTGGTTGGGGG - Intergenic
1200555677 Y:4633835-4633857 TTTTTTAAGGTGAGAGATGGGGG + Intergenic
1200903490 Y:8457571-8457593 CTCTTTTAGGGGAGGCCTGGTGG + Intergenic
1201286748 Y:12385575-12385597 TTTTTGGGGGGGGGGGTTGGGGG + Intergenic
1201507892 Y:14724642-14724664 TTTTTTTTGGGGGAGGTAGGGGG + Intronic
1201509468 Y:14742962-14742984 TTTTTTTGGGGTGGGGTTGAGGG - Intronic
1201580846 Y:15510859-15510881 TTTTTTGGGGGGGGGGTAGGGGG - Intergenic
1201580847 Y:15510860-15510882 TTTTTTTGGGGGGGGGGTAGGGG - Intergenic
1201991603 Y:20032902-20032924 TTCTTTTAGGGCAGGCTGGGTGG - Intergenic
1202046615 Y:20742096-20742118 TTTTTTTAGGCCAGGCATGGTGG - Intergenic
1202576818 Y:26336569-26336591 TTTTTTTATGGTAGAGATGGGGG - Intergenic