ID: 1164286027

View in Genome Browser
Species Human (GRCh38)
Location 19:23818636-23818658
Sequence GTGATTTAGCATGTAAATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164286023_1164286027 -7 Left 1164286023 19:23818620-23818642 CCTGCAACCATATGATGTGATTT 0: 1
1: 0
2: 4
3: 30
4: 225
Right 1164286027 19:23818636-23818658 GTGATTTAGCATGTAAATAGGGG 0: 1
1: 1
2: 0
3: 9
4: 173
1164286022_1164286027 2 Left 1164286022 19:23818611-23818633 CCAGTACTGCCTGCAACCATATG 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1164286027 19:23818636-23818658 GTGATTTAGCATGTAAATAGGGG 0: 1
1: 1
2: 0
3: 9
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164286027 Original CRISPR GTGATTTAGCATGTAAATAG GGG Intronic
903980573 1:27184557-27184579 CTGATTTAGCATGCAAATCTGGG - Intergenic
909835929 1:80254600-80254622 GTCATTTAGGATGAAAATAAAGG - Intergenic
910779324 1:90911492-90911514 CTTATTTAGTATGTAAAAAGTGG - Intergenic
911427621 1:97740199-97740221 GTGATTTATCATGAAAATCCAGG - Intronic
912137378 1:106678459-106678481 GAGATTTAGAATTTAAATAATGG + Intergenic
912743967 1:112229347-112229369 GTTGGTTAGCATGTAAACAGTGG + Intergenic
915058216 1:153156988-153157010 GTGGTTTACCCTGTAAATTGAGG - Intergenic
917393638 1:174567467-174567489 GTGATTTAATATCTAAATAAAGG + Intronic
917788651 1:178486157-178486179 GTAATTTAGGATGGAAATGGAGG - Intergenic
919292631 1:195652167-195652189 GTGATGGAGAATGTCAATAGTGG + Intergenic
1063106256 10:2995525-2995547 GTGATTTATCCTGTAAATTCAGG + Intergenic
1064981260 10:21169725-21169747 TTGATTGAGCAGATAAATAGGGG - Intronic
1066479058 10:35777865-35777887 GTGATTTATGTTGGAAATAGAGG + Intergenic
1066680666 10:37934784-37934806 ATGATTAAGGATGTAAATATAGG + Intergenic
1067005149 10:42653851-42653873 TTGGTTTAACATGTAAATAGGGG - Intergenic
1069524321 10:69154200-69154222 GGGATTCAGCAGGTAAATGGTGG + Intronic
1069537353 10:69264713-69264735 GGGATTCAGCAGGTAAATGGCGG - Intronic
1071681871 10:87714009-87714031 ATGATTAAGAATGTAAAAAGAGG - Intronic
1071688551 10:87790108-87790130 GTATTTTAACATGTAAATACAGG + Intronic
1072335194 10:94391573-94391595 TTGGTTGAGCATGTAAATGGGGG - Intergenic
1073840117 10:107489101-107489123 GTGATGGGGCATGTATATAGTGG - Intergenic
1077263457 11:1636164-1636186 GTGATTTAGTAAATAAATAAAGG + Intergenic
1078867118 11:15307981-15308003 GTGGGTTAACATGTAAATAAGGG + Intergenic
1078895392 11:15592810-15592832 GTGATTTGGCAGGTAAATGCTGG + Intergenic
1079914708 11:26354101-26354123 GTGATTCAGCAGGTGATTAGAGG + Intronic
1080060378 11:27950387-27950409 GTTATTGAGCAAGTAAGTAGTGG + Intergenic
1080078880 11:28188889-28188911 GTGATTATTCATTTAAATAGTGG + Intronic
1080189474 11:29526751-29526773 GTGGTTGAGCATATATATAGGGG - Intergenic
1081211039 11:40334124-40334146 GTGTTTTAGTATGTATACAGAGG + Intronic
1081423074 11:42895385-42895407 TTGTTTTTGCATTTAAATAGTGG + Intergenic
1081472416 11:43387801-43387823 GTGATGTATCATGTAAGGAGGGG + Intronic
1083090267 11:60192160-60192182 TTGGTTGAGCATGTAAATGGGGG - Intergenic
1083794214 11:65005312-65005334 GGGATTTCACATGTAAATAGCGG + Intergenic
1087131241 11:94671247-94671269 GTAATTTTGCATGAAAATGGTGG - Intergenic
1088547254 11:110972172-110972194 GTAATTTAGGAAGTAAAGAGGGG - Intergenic
1090008011 11:123019509-123019531 GTGGTTTAGGAGGTAAACAGAGG - Intergenic
1090914293 11:131149445-131149467 GTGATTAAGTATGAAAATTGAGG + Intergenic
1091814124 12:3423390-3423412 TTGGTTGAGCATGTAAATGGGGG + Intronic
1092306557 12:7306751-7306773 GTGATTTAGAATGCTAATATTGG - Intronic
1093671384 12:21880189-21880211 GTGATTTAGTAGGTAAATCAGGG - Intronic
1093956676 12:25228444-25228466 GTGTTGTAGCATGTATATACAGG - Intronic
1096038900 12:48497091-48497113 TTGAGCTAGCATGAAAATAGAGG - Intergenic
1098248773 12:68546936-68546958 TTGGTTGAGCATGTAAATGGGGG - Intergenic
1098992578 12:77080218-77080240 GTGGTTTAGCAGGTCAATAAGGG - Intergenic
1100882629 12:99035560-99035582 TTTATTTAGCATGTAAACATGGG - Intronic
1101154948 12:101918486-101918508 GTGACCTAGCATGAAAACAGTGG + Intronic
1106492268 13:30237107-30237129 GTGATTAAGCATGTATTTAATGG - Intronic
1106557136 13:30819255-30819277 GAGATTTAGCATGGAAGAAGTGG - Intergenic
1109519595 13:63491539-63491561 GTGATTAGACAGGTAAATAGTGG + Intergenic
1110975204 13:81824596-81824618 GTGATTTAACATTTAATGAGTGG + Intergenic
1112486562 13:99825561-99825583 AGGATTTAGAATGTAATTAGTGG + Intronic
1112764282 13:102724199-102724221 GAGATTTGGCATGCAAATGGAGG + Intergenic
1119983012 14:79103251-79103273 GTGATTTGGGATTTAAAAAGAGG + Intronic
1122185862 14:99995253-99995275 GTGAAATAACATGTAAATAATGG - Intronic
1122332750 14:100935290-100935312 GTCATTTTGCATAGAAATAGGGG - Intergenic
1123218715 14:106837349-106837371 GCTGTTGAGCATGTAAATAGGGG + Intergenic
1127095890 15:55512039-55512061 TTGGTTGAGCATGTAAATGGGGG + Intergenic
1131941361 15:97569782-97569804 GTTATCTAGCTTGTAAGTAGTGG - Intergenic
1132084492 15:98896192-98896214 GTGCTTTAGCAAGAAAATAATGG + Intronic
1133075626 16:3278661-3278683 GTGATCTAATATGCAAATAGAGG + Intronic
1135875378 16:26195173-26195195 GTGATTTAGCACATAAATCTGGG - Intergenic
1137021011 16:35427691-35427713 GTGATTTAGAATCTCACTAGTGG + Intergenic
1137041334 16:35615637-35615659 TTGGTTGAGCATGTAAATAGGGG + Intergenic
1137999637 16:53262265-53262287 GTGATTTAAATTGTAAATAATGG + Intronic
1138021901 16:53491745-53491767 GTCATTTATCATTTAAATACCGG + Exonic
1150573786 17:66412037-66412059 GTGATGTTCCATGAAAATAGTGG - Intronic
1152049420 17:77960129-77960151 GTGATTCTGCACGTAATTAGTGG + Intergenic
1153456187 18:5285023-5285045 GTGACATAGCCTGAAAATAGTGG + Intergenic
1155077129 18:22368918-22368940 GTGATTTCAGATGTAAAAAGTGG - Intergenic
1158292480 18:55956946-55956968 TTGGTTGAGCATGTAAATGGGGG - Intergenic
1159322058 18:66865485-66865507 GTGATTAAGGATGTTAATAGGGG - Intergenic
1163091815 19:15025295-15025317 GTGAATTAGCAAGTAAATTTGGG - Intergenic
1163965971 19:20747874-20747896 CCGATTGAGCATGTAAATGGGGG + Intronic
1164216524 19:23155541-23155563 TTGGTTGAGCATGTAAATGGAGG + Intergenic
1164286027 19:23818636-23818658 GTGATTTAGCATGTAAATAGGGG + Intronic
1167991940 19:53367894-53367916 GTGGTTAAGCGTGTAAATCGGGG + Intronic
1168003962 19:53470961-53470983 GCGGTTAAGCATGTAAATTGGGG + Intronic
925124236 2:1442845-1442867 GTGATTGATTATGTAAATAATGG + Intronic
930440669 2:51401621-51401643 GTGTTGTAGCATGGAGATAGAGG - Intergenic
935721105 2:105980122-105980144 TTGGTTGAGCATGTAAATGGGGG + Intergenic
937032902 2:118755505-118755527 GTTATTTAGCCTGTAAGTGGAGG - Intergenic
937546361 2:123026397-123026419 GTGATTTGGTAAGTAAATACAGG + Intergenic
937717636 2:125052646-125052668 GTGTTTTAGCCCTTAAATAGGGG + Intergenic
939570517 2:143834900-143834922 GTGATTGAGCATGGAATGAGCGG - Intergenic
943270657 2:185798538-185798560 GTGATGTAGCAAGTAATTATTGG - Intronic
943364015 2:186952275-186952297 GTCACTTAGCATGTAAAGAAGGG - Intergenic
943715609 2:191149171-191149193 GTGATTAATCATGTAAAAGGGGG - Intronic
945628647 2:212242763-212242785 GTTTTTTAGCATTTAAATTGTGG + Intronic
945784143 2:214212571-214212593 CTAACTTAGCATATAAATAGTGG - Intronic
947595326 2:231407768-231407790 CTGATTGAGCATGTAGATGGGGG - Intergenic
948178064 2:235959648-235959670 GTGAATTAGGATGTGAATTGAGG - Intronic
1173491046 20:43481995-43482017 CTGATTTAGCATGAAAATCTGGG + Intergenic
1173851599 20:46222017-46222039 GTCAGCTAGCATGTAAATGGTGG - Intronic
1176875579 21:14123719-14123741 TTGGTTTCACATGTAAATAGGGG - Intronic
1181421758 22:22804472-22804494 GTGATTTATAATGAAAATAAAGG + Intronic
1182185800 22:28400732-28400754 GTGACTTAATATGTAAATATTGG + Intronic
950942961 3:16912461-16912483 GTGGTTTAACATGTGTATAGTGG + Intronic
950992703 3:17458004-17458026 GTGACTTAGTATGTAGGTAGTGG - Intronic
956510900 3:69992259-69992281 GTGATTCAGCCTATATATAGGGG - Intergenic
956816159 3:72910396-72910418 GTCATATAGCAAGTACATAGTGG - Intronic
961417592 3:126771720-126771742 GTGATTTAGGTTGTTAATTGGGG + Intronic
963668917 3:148227274-148227296 GTTATTTATAATGTAAATAAAGG + Intergenic
965292588 3:166902857-166902879 GTGATTAAGCTTGAAAATTGAGG - Intergenic
966756709 3:183378206-183378228 GTGGTTTAGAATGTACACAGTGG - Intronic
967145703 3:186604217-186604239 GTCACATAGCAAGTAAATAGTGG + Intergenic
970300023 4:14671341-14671363 TTGATTTAGCAAGAAAACAGTGG - Intergenic
972110910 4:35558860-35558882 GTGAGTCAGCATGTGATTAGTGG - Intergenic
974500926 4:62701636-62701658 GTGGTTAAGCATATAGATAGAGG - Intergenic
974989182 4:69063418-69063440 GTGATTAAGCATGTAAATAGGGG - Intronic
977269979 4:94905872-94905894 GTATTTTAACATTTAAATAGTGG + Intronic
977445579 4:97127562-97127584 GTGATTCATCATGTAAACAAAGG + Intergenic
977490870 4:97708456-97708478 GAGTTCTAGCATGTAATTAGAGG + Intronic
978200745 4:106021317-106021339 ATAATTTAACATGTAAATACTGG - Intergenic
978428981 4:108612859-108612881 GTCATTGTGGATGTAAATAGGGG + Intergenic
980692684 4:136316501-136316523 GTGGTTTATCATGTAAACAAGGG - Intergenic
982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG + Intronic
982703422 4:158682138-158682160 GTGATTTATCATGTGATTATTGG + Intronic
983231432 4:165132988-165133010 CAAATTTAGCATGAAAATAGTGG - Intronic
984159762 4:176237702-176237724 GTGATATAGAAAGTAAAAAGTGG + Intronic
984413239 4:179424237-179424259 GTTTTCTACCATGTAAATAGTGG - Intergenic
985353267 4:189089712-189089734 TTGACTTTGAATGTAAATAGCGG - Intergenic
987660255 5:20863580-20863602 ATGATTTAGAATGAATATAGTGG - Intergenic
987912925 5:24171887-24171909 GTCATTTATCATTTAAATACCGG - Intronic
987930301 5:24392841-24392863 TCGATTGAGCATGTAAATGGGGG + Intergenic
988428337 5:31090196-31090218 GTGTTTTAACATGTAGATATAGG + Intergenic
988763392 5:34342088-34342110 ATGATTTAGAATGAATATAGTGG + Intergenic
989095659 5:37779087-37779109 TTGGTTGAGCATGTAAATGGGGG + Intergenic
989797033 5:45487920-45487942 GTGTTTTATCATTTAAAAAGAGG - Intronic
990566043 5:57030288-57030310 GTGATTTAGCATGTAATTCTAGG + Intergenic
992989339 5:82268308-82268330 TTGGTTGAGCATGTAAATGGGGG + Intronic
994687887 5:102979282-102979304 GAGATTTACCATATAAATAGGGG - Intronic
997145180 5:131425434-131425456 GTGATTTGGCCTATAAACAGTGG - Intronic
1005217540 6:23548857-23548879 CTGATTTCGCATGAAAAGAGTGG - Intergenic
1005815706 6:29550631-29550653 GTCATTGTGCTTGTAAATAGAGG - Intergenic
1005888570 6:30117233-30117255 GTCATTCAGTAAGTAAATAGTGG + Intergenic
1009301391 6:62027564-62027586 GTAATTTATCATGTGATTAGAGG + Intronic
1012013417 6:93823091-93823113 TTGTTTTATCATGTAAATTGTGG + Intergenic
1012661607 6:101902987-101903009 ATGATGTAGCAGGTAGATAGAGG - Intronic
1014816944 6:125946403-125946425 GGGATCTAGCATGTAAGTGGAGG + Intergenic
1015172298 6:130266925-130266947 TTGGTTGAGCATGTAAATGGGGG - Intronic
1018301302 6:162405548-162405570 GAGCTTTAGCATGTAAATGTTGG - Intronic
1018860252 6:167706099-167706121 GTGTAATAGCATGTAAATATTGG - Intergenic
1020556754 7:9680043-9680065 GTGAGTGAGCATGTACAAAGAGG + Intergenic
1020885036 7:13809992-13810014 GTAATCCAGCATGTAAACAGAGG + Intergenic
1024756230 7:52536060-52536082 TTGATCTATCATGTAAATATAGG - Intergenic
1026271064 7:68837299-68837321 CAGATTTAGCAGGTAAATAGGGG + Intergenic
1027626406 7:80550337-80550359 GTGTTTTCTCATGTAAAAAGGGG + Intronic
1028333589 7:89625249-89625271 GTGTTTTAGCATGAGACTAGGGG - Intergenic
1031300031 7:120053888-120053910 GTGGTTGAACATGTAAATAGGGG + Intergenic
1032311844 7:130794713-130794735 GGTATGTAGTATGTAAATAGAGG + Intergenic
1033108898 7:138557862-138557884 GCAGTTGAGCATGTAAATAGAGG + Intronic
1033365270 7:140668391-140668413 GTGGTTAAGCATGTAAATTGGGG - Intronic
1036021085 8:4847488-4847510 CTAATTTAACATGTTAATAGTGG - Intronic
1036982537 8:13486557-13486579 GTAACTTAGAATGTTAATAGTGG - Intronic
1037082320 8:14802719-14802741 GTGTTTTAGCATGTGTATTGTGG + Intronic
1038090052 8:24242313-24242335 TTGGTTGAGCATGTAAATGGGGG - Intergenic
1039509896 8:38082912-38082934 TCGGTTTAACATGTAAATAGGGG + Intergenic
1040599128 8:48866912-48866934 ATGATTGAGCATGTGAAAAGTGG - Intergenic
1040710199 8:50178590-50178612 TTGATTTTGCAGATAAATAGAGG - Intronic
1041008671 8:53520301-53520323 TTGATTGAGCATGTAGATGGGGG + Intergenic
1041031154 8:53736501-53736523 TTGATTGAGCATGTAGATGGGGG - Intronic
1042576341 8:70224494-70224516 ATAATTTATCATCTAAATAGTGG + Intronic
1045907090 8:107359358-107359380 GAGATATAGTATTTAAATAGGGG - Intronic
1046426115 8:114052313-114052335 GTTATTTAACATATAAATAATGG + Intergenic
1051628234 9:19118648-19118670 GTGATTTAATAGTTAAATAGAGG - Intronic
1052371151 9:27665791-27665813 ATGATTGAGCAAATAAATAGAGG - Intergenic
1052508461 9:29383645-29383667 TTGGTTGAGCATGTAAATGGGGG - Intergenic
1058749482 9:108025226-108025248 GTTATTTCCCAGGTAAATAGAGG - Intergenic
1059520232 9:114933868-114933890 GTTATGTGGCATGAAAATAGAGG - Intergenic
1060306280 9:122415507-122415529 GTAATTTACCATATCAATAGAGG - Intergenic
1187537502 X:20156410-20156432 GTTATTTAGCAGGGAAAAAGCGG - Intronic
1188432906 X:30126737-30126759 GAGATATAGTATGTAAATAAAGG - Intergenic
1190771621 X:53519424-53519446 TTGGTTGAGCATGTAAATGGGGG - Intergenic
1193070573 X:77301562-77301584 TTGGTTGAGCATGTAAATGGGGG - Intergenic
1193220122 X:78914323-78914345 GTGATTTTGCATATTAATATTGG + Intergenic
1194600670 X:95917511-95917533 GGAATTTAACATGTAAAAAGGGG + Intergenic
1195317141 X:103690162-103690184 GTCATATAACTTGTAAATAGTGG + Intergenic
1196089459 X:111724475-111724497 TTCATTTAGCATGTCCATAGTGG + Intronic
1196282159 X:113834397-113834419 AAGGTTTAGCATTTAAATAGTGG - Intergenic
1196740205 X:119018262-119018284 GTGGTTTACCATGTACCTAGGGG + Intronic
1200912594 Y:8544217-8544239 CTGGTTGAGCATGTAAATGGGGG - Intergenic
1201259767 Y:12147711-12147733 TTGGTTGAGCATGTAAATGGGGG + Intergenic
1202126981 Y:21577255-21577277 GTGATAAAGCATGTAATTACTGG + Intergenic
1202152146 Y:21853265-21853287 TTGGTTGAGCATGTAAATGGGGG + Intergenic