ID: 1164286081

View in Genome Browser
Species Human (GRCh38)
Location 19:23819002-23819024
Sequence ATTCCCTTTAACCACGTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 74}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164286081_1164286083 25 Left 1164286081 19:23819002-23819024 CCTTTAACGTGGTTAAAGGGAAT 0: 1
1: 0
2: 1
3: 5
4: 74
Right 1164286083 19:23819050-23819072 ATACCTAGCATGGAGAGAAGAGG 0: 1
1: 0
2: 0
3: 12
4: 237
1164286081_1164286082 15 Left 1164286081 19:23819002-23819024 CCTTTAACGTGGTTAAAGGGAAT 0: 1
1: 0
2: 1
3: 5
4: 74
Right 1164286082 19:23819040-23819062 TAACATGTTTATACCTAGCATGG 0: 1
1: 0
2: 2
3: 12
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164286081 Original CRISPR ATTCCCTTTAACCACGTTAA AGG (reversed) Intronic