ID: 1164286081

View in Genome Browser
Species Human (GRCh38)
Location 19:23819002-23819024
Sequence ATTCCCTTTAACCACGTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 74}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164286081_1164286082 15 Left 1164286081 19:23819002-23819024 CCTTTAACGTGGTTAAAGGGAAT 0: 1
1: 0
2: 1
3: 5
4: 74
Right 1164286082 19:23819040-23819062 TAACATGTTTATACCTAGCATGG 0: 1
1: 0
2: 2
3: 12
4: 126
1164286081_1164286083 25 Left 1164286081 19:23819002-23819024 CCTTTAACGTGGTTAAAGGGAAT 0: 1
1: 0
2: 1
3: 5
4: 74
Right 1164286083 19:23819050-23819072 ATACCTAGCATGGAGAGAAGAGG 0: 1
1: 0
2: 0
3: 12
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164286081 Original CRISPR ATTCCCTTTAACCACGTTAA AGG (reversed) Intronic
900588602 1:3447232-3447254 TTTCCCACTAAGCACGTTAAGGG + Intergenic
911326568 1:96475379-96475401 ATTCCCTTTAATCAAGCTGAGGG - Intergenic
911454194 1:98102703-98102725 ATTCCCCTTAACTACGTAAACGG - Intergenic
919967653 1:202544768-202544790 GTTCCCTTTATGCACATTAATGG - Intronic
922035197 1:221840877-221840899 TTTCACTTTAACCTCATTAAGGG - Intergenic
922552391 1:226505520-226505542 ATTCCCTGTCACCACCTTTAGGG + Intergenic
923316698 1:232787186-232787208 ATTCCCTTTGGCCATGTAAATGG - Intergenic
923366803 1:233269612-233269634 ATTTACTTTAACCACATTGATGG - Intronic
924073804 1:240311512-240311534 ATTCACCTTAAGCACGTTTATGG - Intronic
1064742700 10:18449745-18449767 ACTTCCCTTAACCATGTTAAAGG + Intronic
1065172176 10:23042441-23042463 ATTCCCTTAAAACATGCTAAAGG - Intergenic
1074128127 10:110546578-110546600 ATTCTCTGTAAACACGTTGAGGG + Intergenic
1078795158 11:14584908-14584930 AGTCCCTTTAACCATGTGAAAGG - Intronic
1086857778 11:91887140-91887162 ATTACTTTTAATCACTTTAATGG + Intergenic
1095276362 12:40287844-40287866 ACTACCTTTAACAAGGTTAAGGG - Intronic
1099575719 12:84378589-84378611 ATTCCCTATTACCAAGTTGAGGG + Intergenic
1101866598 12:108524926-108524948 CTCCCCTTTATCCAGGTTAATGG - Intronic
1102950570 12:117028152-117028174 TTTCCCTATAACCATGTTTAGGG + Exonic
1111366652 13:87255625-87255647 ATTCTCTATAACCACGTACAAGG - Intergenic
1116473084 14:45307769-45307791 ATTTCCTTTGGCCACGATAATGG - Intergenic
1116902086 14:50371336-50371358 ATTCCCATCAACAACTTTAAGGG + Intronic
1117806844 14:59502219-59502241 ATTGCTTTTAAATACGTTAATGG + Intronic
1122445727 14:101767001-101767023 ATTCGTTTTAAGCACATTAAAGG + Intronic
1135530125 16:23245903-23245925 TTTCCATTTAAACACATTAATGG + Intergenic
1137401265 16:48156049-48156071 ATTCCCTCTGCCCACATTAAAGG + Intergenic
1140967042 16:79976983-79977005 ATTTCCTTCTTCCACGTTAATGG + Intergenic
1146090695 17:29874426-29874448 ACTCCCTATAACCCCGATAAGGG + Intronic
1146795055 17:35774758-35774780 ATTCCCTCTCTCCTCGTTAAGGG - Intronic
1150137889 17:62705673-62705695 AATCCCTTACACCACTTTAAAGG + Intronic
1155382137 18:25235459-25235481 ACTTCATTTCACCACGTTAATGG + Intronic
1160482786 18:79257862-79257884 CTTCTCTTTCACCACGTAAAAGG + Intronic
1164286081 19:23819002-23819024 ATTCCCTTTAACCACGTTAAAGG - Intronic
924966626 2:82414-82436 ATTCCCTTTAGACAAGTTATTGG - Intergenic
928425041 2:31170888-31170910 TTTCCCTTTAACCATCTTAAGGG - Intergenic
928993093 2:37256278-37256300 CTTCTCTTTAACCACCTTACAGG - Intronic
929885816 2:45877136-45877158 ATTTCCTTTGAGCACCTTAAAGG + Intronic
936810141 2:116388814-116388836 ATTCCCTCTACCCATGGTAATGG - Intergenic
942403422 2:175627639-175627661 ATCCCCTTCATCCAAGTTAAAGG - Intergenic
942480034 2:176375732-176375754 ATTCCCTAAAACAACGTTGACGG - Intergenic
1175590560 20:60187738-60187760 AGTTCCTTTAACCACTTTAAAGG + Intergenic
1175730004 20:61347945-61347967 CTTCCCTTTAACCATGGAAAGGG - Intronic
1177842131 21:26246394-26246416 ATTCCCTTTTAGCATGTAAAAGG - Intergenic
1179317016 21:40252979-40253001 ATTCCATTTACCCACTTTACAGG - Intronic
1183814923 22:40291851-40291873 ATTCCTTTTGACCACATTATAGG + Intronic
956624844 3:71256999-71257021 ATTCCCTTTGGCCAACTTAAAGG - Intronic
958863579 3:99473117-99473139 AGTCCTTTCAACCACTTTAATGG - Intergenic
959432463 3:106271490-106271512 GTTTTCTTTAACCACGTCAAGGG + Intergenic
963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG + Exonic
965144241 3:164879073-164879095 ATGCCCTTTAACCAATTGAATGG + Intergenic
967394709 3:188994417-188994439 ATTCCCTGTAATCAGGTGAAGGG - Intronic
972343993 4:38177498-38177520 ATTCCCATTAACCAAGTAATGGG - Intergenic
979982622 4:127275506-127275528 TTACCCTTTAACCATTTTAAAGG + Intergenic
980438469 4:132811856-132811878 TTTTCTTTTAAACACGTTAATGG + Intergenic
983335234 4:166383689-166383711 ATTGCCTTTAACCATGTTAATGG - Intergenic
985429966 4:189869923-189869945 AATCCCTTTCACCATGTTCATGG - Intergenic
985788721 5:1913756-1913778 ATCACCTTTAACCAGGTGAATGG - Intergenic
986349495 5:6864544-6864566 ATTCTCGTTAACAACGTTTAAGG + Intergenic
988349793 5:30087254-30087276 GTGCCCTTTACCCACTTTAATGG - Intergenic
993310683 5:86328348-86328370 AATCCATTCAACCAAGTTAATGG + Intergenic
1005052892 6:21701647-21701669 AATCCCTTGAATCACGGTAAGGG + Intergenic
1011515106 6:88145112-88145134 ATTCCCTTTAACTTCCTTTAGGG - Exonic
1013429803 6:110045496-110045518 ATTTCCTTTAACACGGTTAAAGG + Intergenic
1013429804 6:110045500-110045522 GTTTCCTTTAACCGTGTTAAAGG - Intergenic
1015414570 6:132933964-132933986 TTTCTATTTAACCACTTTAATGG + Intergenic
1017501014 6:155022913-155022935 ATTCACTTTATCCACGTCCATGG - Intronic
1022941559 7:35245959-35245981 AATTCCTTTATCCACGTAAAAGG + Intronic
1028464341 7:91133339-91133361 AATTCCTTAAACCACCTTAATGG + Intronic
1032389421 7:131546362-131546384 ACTGCATTTAACCACGTTATGGG + Intronic
1034134715 7:148756023-148756045 TTACCCTTTAAAAACGTTAATGG - Intronic
1035707942 8:1691652-1691674 GTTCCCTGTAACCAAGCTAATGG + Intronic
1036115584 8:5957173-5957195 AATATCTTTAACCACGTTAAGGG + Intergenic
1043803323 8:84639542-84639564 ATTTCCTTTAGCCAAGATAAGGG + Intronic
1045201606 8:99988783-99988805 ATTCACTTTATCCGGGTTAATGG - Intronic
1045285744 8:100789697-100789719 AATACCATTAACCAAGTTAAAGG + Intergenic
1055122025 9:72671517-72671539 ATTCCATTTTACCACCTTTATGG - Intronic
1055605011 9:77960058-77960080 ATTCTCTTTAACCAAGAGAATGG + Intronic
1185798968 X:2992151-2992173 ATTACATTTCTCCACGTTAAAGG + Intergenic
1186717250 X:12265507-12265529 ATGCCCTTTAAACACGTATATGG - Intronic
1197247826 X:124184704-124184726 ATTTCCTTAAACCTCGTTCAAGG + Intronic
1202303253 Y:23440528-23440550 GTTCCCTTTATGCACATTAATGG - Intergenic
1202567558 Y:26230066-26230088 GTTCCCTTTATGCACATTAATGG + Intergenic