ID: 1164286082 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:23819040-23819062 |
Sequence | TAACATGTTTATACCTAGCA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 141 | |||
Summary | {0: 1, 1: 0, 2: 2, 3: 12, 4: 126} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1164286080_1164286082 | 16 | Left | 1164286080 | 19:23819001-23819023 | CCCTTTAACGTGGTTAAAGGGAA | 0: 1 1: 0 2: 1 3: 3 4: 77 |
||
Right | 1164286082 | 19:23819040-23819062 | TAACATGTTTATACCTAGCATGG | 0: 1 1: 0 2: 2 3: 12 4: 126 |
||||
1164286081_1164286082 | 15 | Left | 1164286081 | 19:23819002-23819024 | CCTTTAACGTGGTTAAAGGGAAT | 0: 1 1: 0 2: 1 3: 5 4: 74 |
||
Right | 1164286082 | 19:23819040-23819062 | TAACATGTTTATACCTAGCATGG | 0: 1 1: 0 2: 2 3: 12 4: 126 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1164286082 | Original CRISPR | TAACATGTTTATACCTAGCA TGG | Intronic | ||