ID: 1164286083

View in Genome Browser
Species Human (GRCh38)
Location 19:23819050-23819072
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 237}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164286080_1164286083 26 Left 1164286080 19:23819001-23819023 CCCTTTAACGTGGTTAAAGGGAA 0: 1
1: 0
2: 1
3: 3
4: 77
Right 1164286083 19:23819050-23819072 ATACCTAGCATGGAGAGAAGAGG 0: 1
1: 0
2: 0
3: 12
4: 237
1164286081_1164286083 25 Left 1164286081 19:23819002-23819024 CCTTTAACGTGGTTAAAGGGAAT 0: 1
1: 0
2: 1
3: 5
4: 74
Right 1164286083 19:23819050-23819072 ATACCTAGCATGGAGAGAAGAGG 0: 1
1: 0
2: 0
3: 12
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type