ID: 1164286698

View in Genome Browser
Species Human (GRCh38)
Location 19:23823245-23823267
Sequence TGTATTGGGGAGGAAATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 367}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164286698 Original CRISPR TGTATTGGGGAGGAAATGGG AGG (reversed) Intronic
900076036 1:818552-818574 TGAATTTGGGTAGAAATGGGTGG + Intergenic
900819717 1:4877240-4877262 TGTATTGGTGAGGGAATAAGTGG - Intergenic
901116518 1:6849671-6849693 AGTTTTGAGGAGGAAATGGAGGG + Intronic
902296939 1:15474118-15474140 TGTATGGGTAAGAAAATGGGTGG - Intronic
902524392 1:17046280-17046302 GGTATTTGGGAGGAAGTGAGAGG + Intronic
902910469 1:19593043-19593065 TGTATTGGGGAAGGAATGGTGGG + Intergenic
903515744 1:23909699-23909721 TGCGCTGGGGAGGAAATTGGAGG - Intronic
904121482 1:28201155-28201177 TATGTTGGGGTGGAAGTGGGAGG + Exonic
904649062 1:31990659-31990681 TGAATAGGAGAGGAAATGGAGGG - Intergenic
904943587 1:34182485-34182507 TGTGTGGGAGAGGAAGTGGGAGG + Intronic
905012901 1:34759235-34759257 TGGATTGTGTAGGAAATGGGAGG - Intronic
905106368 1:35565755-35565777 TGTTTTGGGGAGGAAGTCTGGGG - Exonic
905108523 1:35577843-35577865 GGTATTGGGCAGGAAATGGCAGG + Intronic
906390724 1:45413311-45413333 TCTATTTGGGAGGAAAAGTGTGG - Intronic
906391042 1:45416723-45416745 GGGATGGGGGAGGAAATAGGGGG - Intronic
907400931 1:54224322-54224344 TGTGTTGGGGAGTAGCTGGGAGG - Intronic
910758502 1:90714242-90714264 TGATTTGGGGATGAAGTGGGGGG + Intronic
911790505 1:102010337-102010359 TATAATGGGGAAGAAAGGGGTGG - Intergenic
913111887 1:115664391-115664413 TGGTTTGGGGAGGAGATGCGAGG + Intronic
913706399 1:121428533-121428555 TGATTTGGGGAGGGGATGGGTGG + Intergenic
915032895 1:152899290-152899312 TTTATTGGGGAGGAAGGGTGGGG + Intergenic
916001602 1:160621692-160621714 AGTCTTGGGGAGGAAATGTGGGG + Intronic
917345940 1:174028260-174028282 TGGACTGGGGAGGAAGTAGGAGG - Intergenic
920827592 1:209436059-209436081 TGTGTTTGGGAAGAGATGGGTGG + Intergenic
922024398 1:221737312-221737334 TGTCTTGGGGAGCAAAGAGGAGG - Intronic
923130805 1:231073148-231073170 ATCATTGGGCAGGAAATGGGAGG + Intergenic
923998930 1:239529038-239529060 TGGATTATGAAGGAAATGGGAGG - Intronic
1062962219 10:1581122-1581144 TGTATTGGCGAGGATATAGAGGG - Intronic
1062985520 10:1765150-1765172 TGTACAGGTGAGGAAATGGGCGG + Intergenic
1064599061 10:16974773-16974795 TGGGTTGGGGAGGAAGAGGGAGG - Intronic
1065036093 10:21639898-21639920 TGTCTTGGGGAGAAAAAGGAGGG + Intronic
1065732659 10:28723459-28723481 TGTATGGGGGAAAAAATGGAAGG - Intergenic
1066660030 10:37729225-37729247 TGGATTGGGGAGGAAGTTGCAGG + Intergenic
1067038119 10:42933883-42933905 TGTGTTGGGGAGGAAGTGCCTGG - Intergenic
1068030729 10:51701558-51701580 TTTATTGGGGACGAAAGGGGAGG + Intronic
1069208746 10:65728987-65729009 TGTTATGGGGAGAAAATGGTTGG + Intergenic
1069896191 10:71681617-71681639 TAAAGTGGGGAGGAAATGGAGGG + Intronic
1070428137 10:76309154-76309176 AGGATATGGGAGGAAATGGGCGG + Intronic
1070963659 10:80516492-80516514 TGTATTGGGGAGGAGAATGGTGG + Intronic
1071929378 10:90450235-90450257 GGTGGTGGGGAGGAAATGGCAGG + Intergenic
1072196394 10:93120264-93120286 AATATTGGGGATGAAAGGGGAGG + Intergenic
1073804628 10:107083968-107083990 TGTGTTAGGTAGGAAATGGAAGG - Intronic
1074048526 10:109861356-109861378 TCTCTTGCTGAGGAAATGGGAGG - Intergenic
1074229980 10:111524020-111524042 TTTTTTGGGGAGAAAATGGAAGG + Intergenic
1074326214 10:112454336-112454358 TCTATTGAGTAGGAAATGAGAGG + Intronic
1074523447 10:114245059-114245081 TGTATTGAGGGGGACAGGGGAGG + Intronic
1074645154 10:115441363-115441385 GGGATTGAAGAGGAAATGGGTGG - Intronic
1075212501 10:120502992-120503014 CAGATTGGGGAGGAAATGGATGG - Intronic
1075226601 10:120634915-120634937 TTTATTGCGGGGGAAATGGGAGG - Intergenic
1075435433 10:122436932-122436954 TTTAGTGGGGAGGAAAGGAGGGG + Exonic
1077129973 11:966640-966662 TGCATTGGTGAGGAAGTGGAAGG + Intronic
1080098657 11:28434080-28434102 TGTCGTGGGGAGGAACTAGGTGG + Intergenic
1082923208 11:58518320-58518342 TGGATTGTGGAGAGAATGGGAGG - Intergenic
1083190705 11:61050065-61050087 TGGAAGGGGAAGGAAATGGGAGG - Intergenic
1085596001 11:77810563-77810585 TTTTTTGGGGGGGAGATGGGTGG + Intronic
1085783338 11:79429328-79429350 TTTATTGGGGAGGAGGCGGGAGG - Intronic
1085898742 11:80671192-80671214 TGTATTAGGGAGAAAACAGGGGG + Intergenic
1086129909 11:83390312-83390334 TGGCTTGGTGAGGGAATGGGGGG + Intergenic
1087105009 11:94399987-94400009 TGTGTTGAGGAAGAAATGAGGGG - Intronic
1087192280 11:95267695-95267717 TTTAATGGGGTGGAAAAGGGAGG + Intergenic
1088216155 11:107512255-107512277 TAAATTGGGGAATAAATGGGAGG + Intronic
1088250609 11:107858404-107858426 TGTATTTTGGAGGATTTGGGGGG - Intronic
1088319744 11:108543216-108543238 AGAATTGGGCAGGAAAGGGGAGG - Intronic
1088421890 11:109657599-109657621 TGGATTGAGGAGTGAATGGGAGG + Intergenic
1088480044 11:110287754-110287776 TGTCTTGGGCAGGAAGGGGGAGG - Intronic
1088528782 11:110785900-110785922 AGTATTGAGGGGGAAATGTGGGG + Intergenic
1088827763 11:113510092-113510114 TGTATGGTTGAGGAAATTGGTGG - Intergenic
1088969275 11:114757927-114757949 TTTATTGGGGAGGAAATATAGGG + Intergenic
1089832021 11:121337384-121337406 TGTATTGTGGAGGTAGTGGATGG + Intergenic
1090057556 11:123436646-123436668 TGTAGTGGGGAGGAAGCGTGGGG + Intergenic
1090403543 11:126463936-126463958 TGGATAGGGGAGGAAATAGGTGG + Intronic
1090419060 11:126561551-126561573 GGTGTTGGGGAGGGAAGGGGAGG + Intronic
1091286342 11:134410761-134410783 TGTGTTTGTGTGGAAATGGGAGG - Intronic
1091332795 11:134743822-134743844 TGGGATGGGGAGGAAATGGTGGG - Intergenic
1093410822 12:18864699-18864721 TGTAGTGGGAAGAAAATGGAAGG - Intergenic
1094130677 12:27071611-27071633 TGGAGTGGGGGGGAAAAGGGAGG - Intergenic
1094295575 12:28901150-28901172 TTTTCTGGGGAGGAAATTGGGGG + Intergenic
1094482684 12:30897307-30897329 TGAATTGGGGTGCAGATGGGGGG - Intergenic
1095344641 12:41135440-41135462 TTTATTGAGGAGGAAATGCAGGG + Intergenic
1095384240 12:41631391-41631413 TGTATGGGGGAGGACAGAGGAGG + Intergenic
1096023308 12:48339919-48339941 TATGTTGGGGTGGAAAGGGGAGG + Exonic
1096979033 12:55717969-55717991 TGTGGGAGGGAGGAAATGGGAGG - Intronic
1100379703 12:94049990-94050012 TGTACAGGGCAGGAAGTGGGTGG + Intergenic
1100576121 12:95892999-95893021 TGAATTCGGAAGGTAATGGGAGG - Intronic
1100972310 12:100083423-100083445 GGTATGGGGGAGGGAAGGGGAGG + Intronic
1101572865 12:105971162-105971184 TGTGTTGTGGAGGAATTGGACGG + Intergenic
1102688475 12:114742277-114742299 TGCAGTGGGGAGGAATTGTGGGG + Intergenic
1102946683 12:116995536-116995558 AGTATTGGGCAGGAAATGTTTGG + Intronic
1104308882 12:127635860-127635882 TGTATTGGGGCTGAACTGCGTGG + Intergenic
1104768971 12:131348472-131348494 TGCATCGGGGAGAAAAAGGGAGG + Intergenic
1104810781 12:131619170-131619192 TGCATCGGGGAGCAAAAGGGAGG - Intergenic
1106781495 13:33062902-33062924 TGTATGGGTTAGGGAATGGGTGG + Intronic
1108724760 13:53167871-53167893 TTTATTTGTGAGCAAATGGGAGG - Intergenic
1110249660 13:73367140-73367162 TGTTTTGGGGAGGAAAGTGTTGG - Intergenic
1110431409 13:75428166-75428188 TATTTTGGGGAGGACTTGGGGGG + Intronic
1111196219 13:84876966-84876988 CTTATTGGGAATGAAATGGGTGG - Intergenic
1111745470 13:92263420-92263442 TGTATTGGAGAGGAAAAAGAAGG - Intronic
1112956443 13:105064648-105064670 TGTTTTGGGGAAGAAACGGGGGG + Intergenic
1113245587 13:108391259-108391281 TGTAGTGGGGAGGCTAGGGGAGG - Intergenic
1113493083 13:110707193-110707215 TGTATTGGGGTGTAGATGTGTGG - Intronic
1113570713 13:111354821-111354843 AGTACTGGGGGTGAAATGGGTGG + Intergenic
1116919663 14:50560095-50560117 AGGAGTGGGGAGGAAAAGGGAGG - Exonic
1116963073 14:50986691-50986713 TGAATAGGAGAGGAAATGTGGGG + Intronic
1118912738 14:70075403-70075425 GGCAATAGGGAGGAAATGGGAGG + Intronic
1119074425 14:71621579-71621601 TGAATTGGATATGAAATGGGAGG - Intronic
1119717220 14:76867591-76867613 TGAATTGGGGATGAGAAGGGGGG - Intronic
1120441312 14:84544373-84544395 TGTATTTGGGAGGAAGTTTGAGG - Intergenic
1122080727 14:99265461-99265483 TATATGGGGGAGGGAATGGGAGG - Intronic
1122242547 14:100378515-100378537 TGTGTTGGGAGTGAAATGGGTGG + Intronic
1124048604 15:26174693-26174715 TGCATTGGTCAGGGAATGGGAGG + Intergenic
1126074858 15:44899337-44899359 CGTAGTGTGGAGGAAAAGGGGGG - Intergenic
1126083506 15:44988478-44988500 CGTAGTGTGGAGGAAAAGGGGGG + Intergenic
1127209197 15:56754947-56754969 AGTATTGGGGTGGGAATGAGTGG + Intronic
1127602260 15:60549745-60549767 TTGATTGGGAAGGAGATGGGAGG - Intronic
1127928626 15:63573707-63573729 TAACTTGGGGAGGAAATGGAAGG + Intronic
1128026536 15:64442063-64442085 GGTATCAGAGAGGAAATGGGGGG + Intronic
1128389717 15:67174829-67174851 TGGAGTGGGGAGGAAATGAAAGG - Intronic
1129236689 15:74228000-74228022 GGTAATGGGGTGGAGATGGGTGG - Intergenic
1129628640 15:77233240-77233262 TGGATTGAGGAGAAAATGGAAGG - Intronic
1129705780 15:77793282-77793304 TGTGTTCGGGAGGAAAGGGTAGG - Intronic
1129908618 15:79207751-79207773 TGTTTTCAGGAGGACATGGGAGG - Intergenic
1130660967 15:85831196-85831218 GGGATTGGGAAGGGAATGGGAGG - Intergenic
1132644753 16:993757-993779 TGGATGGGTGAGTAAATGGGTGG - Intergenic
1134435801 16:14255667-14255689 AGGATGGGGGAGGAAATGAGTGG + Intronic
1135047837 16:19168902-19168924 CCTCTTGGGGAGGGAATGGGGGG + Intronic
1136096470 16:27960635-27960657 TGTGGTGGGGAGAAAATGGATGG + Intronic
1136350044 16:29700929-29700951 AGTATTTGGGAGGGGATGGGTGG - Intergenic
1136369476 16:29827007-29827029 CGTATTGTGGAGCAACTGGGGGG + Intronic
1136495475 16:30640706-30640728 GGTAGTGGGGAAAAAATGGGGGG + Intergenic
1136669978 16:31847514-31847536 TTTATTAGGAAGGAAATGGAGGG + Intergenic
1136987444 16:35122420-35122442 TGTATTAAGAAGGAAATGGAGGG + Intergenic
1137361506 16:47821071-47821093 TATATAGAGGAGGAAATGGCAGG - Intergenic
1138279354 16:55761195-55761217 TTTGGTGAGGAGGAAATGGGTGG + Intergenic
1138289174 16:55832480-55832502 TTTGGTGAGGAGGAAATGGGTGG - Intronic
1138520853 16:57570150-57570172 GGTGGTGGGGAGCAAATGGGAGG - Intronic
1138634299 16:58324644-58324666 TGTGTTGAGGAAGAAATGGGGGG + Intronic
1139369377 16:66457188-66457210 AGTATTGGTGAGGGGATGGGTGG + Intronic
1140058503 16:71546720-71546742 TGGGTTGAGGAGGAAATGGAAGG - Intronic
1140296729 16:73716179-73716201 AGTTTAGGGGAGGGAATGGGTGG + Intergenic
1141578424 16:84980856-84980878 GGTATCGGAGAGTAAATGGGTGG - Intronic
1142638905 17:1273748-1273770 TGTTTTGGAGAGTAAATGGGAGG + Intergenic
1143513962 17:7410219-7410241 GGTATTGGGATGGACATGGGTGG - Intronic
1143718858 17:8796451-8796473 TGTGTTGGGGGGGAAGTGGGAGG - Intergenic
1143722257 17:8821291-8821313 TTTACTGGAGAGGAAATGGAAGG - Intronic
1144476913 17:15596459-15596481 GGCACTGGGGAGGAGATGGGTGG - Intronic
1144764291 17:17724467-17724489 TGCTTTGTGGAGGAAAGGGGAGG - Intronic
1144921328 17:18766895-18766917 GGCACTGGGGAGGAGATGGGTGG + Intronic
1145956904 17:28860971-28860993 AGAATTGGGGAGCAGATGGGAGG - Exonic
1146569918 17:33943464-33943486 TGTTTTGAGGATGAAATGGAGGG - Intronic
1146788176 17:35735792-35735814 TGTGTTGGGGTGGAGTTGGGGGG + Intronic
1146862884 17:36320260-36320282 TGTTTGGGAGTGGAAATGGGAGG + Intronic
1147093213 17:38124343-38124365 TGTTTGGGAGTGGAAATGGGAGG + Intergenic
1147103994 17:38196145-38196167 TGTTTGGGAGTGGAAATGGGAGG - Intergenic
1147198723 17:38785130-38785152 TGTATTGATGAGGGAGTGGGAGG - Intronic
1147868289 17:43568762-43568784 TGTATTTGTGAGGATATGTGTGG + Intronic
1148425494 17:47592258-47592280 TGTTTGGGAGTGGAAATGGGAGG + Intronic
1148685510 17:49498365-49498387 TGGATAGGGGAGGAGTTGGGAGG - Intronic
1149431697 17:56599330-56599352 GGTGTGGGGGAGGAAGTGGGGGG - Intergenic
1149952176 17:61000339-61000361 TTTCTTGGTGAGGAAATTGGAGG + Intronic
1150648070 17:66992266-66992288 TAGATTGGGGAGGAGACGGGTGG + Intronic
1152412277 17:80133486-80133508 TGCCTTGGGGAGGAGATGGCAGG - Intergenic
1153053113 18:919021-919043 AGTAATGGGGAGGAAAAGGAAGG - Intergenic
1153815860 18:8789550-8789572 TCTATTGGGGAAGACATGGACGG + Intronic
1158128597 18:54128314-54128336 TGTATTGGGAAGGGACTGGATGG - Intergenic
1158671003 18:59473769-59473791 AGTAGTGGGGAGGAAATAGTGGG - Intronic
1159151476 18:64528907-64528929 TCTCCTGGGGAGGAAAAGGGTGG - Intergenic
1159502236 18:69288529-69288551 GGTATTTGGGAGGAGAAGGGAGG + Intergenic
1160236557 18:77090479-77090501 TTTGTTGGCGAGGAAATGGCAGG - Intronic
1160960800 19:1719940-1719962 TGTATTCGGGAGGAGGTGAGTGG + Intergenic
1161030483 19:2055912-2055934 TCTGTTGGGGAGGAAAGGAGAGG - Intergenic
1161152287 19:2716247-2716269 GGTGGTGGGGAGGAAGTGGGTGG + Exonic
1161565455 19:4999685-4999707 TGGATAGGTGAGTAAATGGGTGG - Intronic
1161565507 19:4999881-4999903 TGGATAGGTGAGTAAATGGGTGG - Intronic
1161565525 19:4999953-4999975 TGGATAGGTGAGTAAATGGGTGG - Intronic
1161565575 19:5000138-5000160 TGGATAGGTGAGTAAATGGGTGG - Intronic
1161733035 19:5973862-5973884 TTTATTGGTGTGGAAACGGGGGG + Intronic
1162192150 19:8955423-8955445 GGTAATGTGGAGGAAATGGGAGG + Exonic
1162663960 19:12194464-12194486 GGGATTGGGGAAGGAATGGGTGG + Intergenic
1163074420 19:14876649-14876671 AGGGTTGGGGAGGAAAGGGGAGG - Intergenic
1164286698 19:23823245-23823267 TGTATTGGGGAGGAAATGGGAGG - Intronic
1164675139 19:30095695-30095717 TGTATTTGGGAGGAAGTGCAGGG + Intergenic
1164783157 19:30909673-30909695 TGTGCTGGGGAGGAGAGGGGAGG + Intergenic
1165985923 19:39768834-39768856 TGTATAGAGCAAGAAATGGGGGG + Intergenic
1166266399 19:41687261-41687283 TGTATTGGGGTGGAAAGATGGGG + Intronic
1166420419 19:42632139-42632161 TGTATTGGGGGGGAAAGATGGGG + Intronic
1167005949 19:46776843-46776865 GGAATTCTGGAGGAAATGGGGGG - Intronic
1167153064 19:47720917-47720939 TGGATTTGGGAGGGCATGGGAGG + Intronic
1167668670 19:50837427-50837449 TGCGGTGGGGTGGAAATGGGAGG + Intergenic
1167690042 19:50979754-50979776 AGGACTGGGGAGGAATTGGGGGG + Intronic
1167733873 19:51279329-51279351 TGTCTTGGGGAGGTAAGGGTGGG + Intergenic
1168106783 19:54170373-54170395 TGTATTTGTGAGGAAAAAGGGGG + Intronic
1168498033 19:56870303-56870325 TGAACTGAGGAGAAAATGGGAGG - Intergenic
925577439 2:5375042-5375064 TCAGTTGGAGAGGAAATGGGGGG - Intergenic
927033482 2:19147545-19147567 TGTATTGGTGAGGTAAGGAGGGG - Intergenic
927861164 2:26561108-26561130 TGAATGGGGGAGGAAGTAGGCGG + Intergenic
929224559 2:39499869-39499891 TTTATTGGGAAAGAAAAGGGGGG - Intergenic
929766106 2:44845089-44845111 TGTGGTGGGGAGGGAAAGGGAGG + Intergenic
930977447 2:57480702-57480724 TGTTGTGGGGAGGGAAGGGGTGG - Intergenic
931553097 2:63468977-63468999 TGTATTTAAGAGAAAATGGGAGG - Intronic
932701804 2:73997293-73997315 TCTTCTGGGGAGGACATGGGTGG + Intronic
933108367 2:78362424-78362446 TGTGTTGGGAAGGAAATGTTCGG + Intergenic
933941121 2:87245915-87245937 TGTATCAGGGATGAAAAGGGTGG + Intergenic
933987363 2:87603109-87603131 AGTTCTGGGGAGGAAATTGGAGG - Intergenic
934520364 2:95016561-95016583 TGTGTTGGGGAGGAAGGGGTCGG - Intergenic
935593900 2:104864695-104864717 GGTCTTGGGGAGGAGGTGGGTGG + Intergenic
936306476 2:111347699-111347721 AGTTCTGGGGAGGAAATTGGAGG + Intergenic
936440654 2:112549255-112549277 TCTTTTTGGCAGGAAATGGGGGG + Exonic
936932351 2:117803107-117803129 TGTATTTGGGAATAAATGAGGGG - Intergenic
937783022 2:125860998-125861020 TGTAATGAGGAGGATCTGGGTGG - Intergenic
938043271 2:128094045-128094067 TAGAGTGGGGAGGAAATTGGGGG - Intronic
938647150 2:133343616-133343638 TGTATTGGGTGGTAAATGGATGG - Intronic
941576084 2:167232031-167232053 TTTATTGAAGAGGCAATGGGTGG - Intronic
941647826 2:168060127-168060149 TGGAGTGGGGTGGAAAGGGGGGG - Intronic
942378839 2:175365748-175365770 TGTATCGGGGAGAAAGTAGGAGG + Intergenic
944453940 2:199874237-199874259 TGTGTTGGGGATGAAATTGCAGG - Intergenic
944554679 2:200875912-200875934 TGTATCAGGGAGGAAAGGGGAGG - Intronic
945800801 2:214427899-214427921 TGTATTGGAAAGGAAATGGATGG - Intronic
946609252 2:221440145-221440167 TGCAGTGGGGAGGAAAGGGGTGG + Intronic
946895918 2:224323505-224323527 TGTTTTGGTGAGAAAATGGAGGG + Intergenic
947244193 2:228028958-228028980 TTTGTTGGGTAGGGAATGGGTGG + Intronic
947644584 2:231729075-231729097 TGTGTTGGGGAGGAGAAAGGGGG - Intergenic
948348148 2:237316626-237316648 TGTGGTGGGGAGGATATGGGAGG - Intergenic
948763010 2:240204215-240204237 TTTCTTGGGGAGGAAATAGCAGG + Intergenic
1169245154 20:4019101-4019123 GGTATAAGGGAGGAGATGGGAGG - Intergenic
1169724182 20:8711597-8711619 TCTATTGTGGAGGAAGTGGGTGG + Intronic
1169845440 20:9986540-9986562 TGTATTAAGGAGGAAAATGGAGG - Intronic
1170621017 20:17996070-17996092 TGTTTTGGAGAGGAATTTGGTGG - Intronic
1170790009 20:19500061-19500083 TATATTGATGAGGAAATGTGTGG + Intronic
1171053453 20:21883232-21883254 TGCTTTGGGGAGGGAGTGGGAGG + Intergenic
1171245250 20:23605755-23605777 TGTTCTGAAGAGGAAATGGGTGG - Exonic
1173306326 20:41853900-41853922 TGTCCTGGGCAGGAAATGAGAGG - Intergenic
1173608920 20:44352365-44352387 TTTATTGGGGGTGGAATGGGAGG - Intergenic
1174674943 20:52344687-52344709 TCTGTTGGGGATGGAATGGGAGG + Intergenic
1179502363 21:41818154-41818176 GGCATTGGGGAGGAAAGGGGAGG + Intronic
1181978039 22:26746044-26746066 TGTGAGGAGGAGGAAATGGGGGG + Intergenic
1182661125 22:31926011-31926033 TGGACTGGGGAGGTGATGGGGGG + Intergenic
1182734396 22:32521054-32521076 TGTATAGGCGAGTAGATGGGAGG + Intronic
1182941135 22:34278504-34278526 TGTATTGGGTGGGAAGTTGGGGG + Intergenic
1184493439 22:44823754-44823776 TGATTTGGGGATGAAATGGACGG + Intronic
1184901551 22:47449456-47449478 TGGATTAGGGAGGAAATGTAAGG + Intergenic
950680034 3:14578874-14578896 TTTATTGGAGAGGAAATTGAGGG - Intergenic
951853153 3:27165736-27165758 TGTTTTGGGGTGGAAATTGTAGG - Intronic
951995446 3:28722708-28722730 TGTATCTGGGAGGCAAAGGGTGG + Intergenic
953361383 3:42300339-42300361 TCTTTTGGGGAGAAAATTGGAGG + Intergenic
953980983 3:47412910-47412932 GGTAGTGGGGAGGAAAGGGGGGG - Exonic
954283290 3:49600099-49600121 TGAATTGGGGATGAAATGGTGGG + Intronic
956263329 3:67369562-67369584 TGTAGCGGGGAGGAAAGGAGAGG + Intronic
956986041 3:74701923-74701945 GGCATGGGGGAGGAAGTGGGAGG - Intergenic
957558163 3:81786816-81786838 TGTTTTAGGTAGGAAATGAGGGG + Intergenic
958186281 3:90123748-90123770 TAGATTGGAGAGGAAATGGCTGG + Intergenic
959343946 3:105168740-105168762 TCTATTGGTGATGAAATGTGTGG - Intergenic
959865610 3:111266694-111266716 GCTATTGGGGAGATAATGGGAGG - Intronic
959961477 3:112303280-112303302 TGTTACTGGGAGGAAATGGGAGG + Intergenic
960219181 3:115083813-115083835 TATATTGGAGAAGAAATGGTAGG + Intronic
960241486 3:115347068-115347090 TGAGTTTGGGAGAAAATGGGAGG + Intergenic
960585709 3:119319836-119319858 TTTACTGGGAATGAAATGGGAGG - Intronic
960666078 3:120110044-120110066 TTTATGTGGTAGGAAATGGGGGG + Intergenic
961095255 3:124149379-124149401 TGCATTGTGGAGGCACTGGGGGG - Intronic
961523072 3:127479163-127479185 TGTGTTGGTGAGGATGTGGGGGG - Intergenic
961785905 3:129346662-129346684 TGGCACGGGGAGGAAATGGGGGG + Intergenic
962173468 3:133127586-133127608 TCTATTGGGGAGACAATGAGGGG - Intronic
962573690 3:136736400-136736422 TATGTTGGGGTGGAAGTGGGAGG + Intronic
962851748 3:139313286-139313308 TGAAATGGAGAGGAAAGGGGAGG + Intronic
963046066 3:141103594-141103616 TGTTGTGCGGAGGGAATGGGAGG - Intronic
964774249 3:160257754-160257776 TGCAGGGAGGAGGAAATGGGGGG - Exonic
965524385 3:169700783-169700805 TGTGTGGTGGAGGAAATGGGTGG - Intergenic
966794370 3:183699178-183699200 TGGATTGGTGAGGGAATGGTGGG + Intronic
967489217 3:190069888-190069910 TGGATTGTGGAGAAAATTGGGGG + Intronic
967720159 3:192807602-192807624 TTAATTGGGGAGGAGAAGGGGGG + Intronic
968560403 4:1277917-1277939 TGGATGGGGGTGGAAATGGGAGG - Intergenic
968610462 4:1554576-1554598 TGGGTGGGGGAGGAATTGGGCGG - Intergenic
969212979 4:5701925-5701947 TGGACTGGGGAGGTAATGGTGGG - Intronic
970326592 4:14931311-14931333 AGTATGGAGAAGGAAATGGGGGG - Intergenic
970756450 4:19432596-19432618 GGTATTGGAGAAGAAATGAGTGG + Intergenic
971129185 4:23787169-23787191 TTTATTGAGGAGGAAATGGAGGG - Intronic
974988402 4:69057707-69057729 TGTAACTGGCAGGAAATGGGAGG + Intronic
976465808 4:85367559-85367581 GGTATTGTAGAGGAAAAGGGGGG + Intergenic
976692150 4:87880323-87880345 GGCATTGGGCAGGAAAGGGGTGG + Intergenic
977749111 4:100587357-100587379 GCTTTTGGGGAGGAAATGGTGGG + Intronic
978088258 4:104682325-104682347 TTTATTGGAGAGGTTATGGGGGG - Intergenic
978788095 4:112632251-112632273 GGAATAGGGGAGGAAATGGCAGG + Intronic
980178141 4:129371815-129371837 TGTGTAGGAGAGGAGATGGGAGG + Intergenic
980269013 4:130559777-130559799 AGTATATGGGAGGAAATGTGCGG - Intergenic
980696156 4:136358927-136358949 TGTATTGTGGGGGAAAAGGAAGG + Intergenic
980922952 4:139105452-139105474 TGTTTTGGGGAGTAAAAGGATGG - Intronic
982833749 4:160096366-160096388 TGTATTGTGTAGGGAATGGCAGG - Intergenic
984054563 4:174910723-174910745 TTTGTTTGGGAGGAAATGAGGGG - Intronic
984403340 4:179295155-179295177 TTCAGTGGGGAGGAAATGTGAGG + Intergenic
985946367 5:3187796-3187818 TGTACTGGGCAGGAAAATGGAGG + Intergenic
986096415 5:4558602-4558624 TGAATTGGGGAGGAATTGACTGG + Intergenic
986714909 5:10516378-10516400 AGTGTTGGGGTGGGAATGGGAGG - Intronic
987937333 5:24482872-24482894 TGTATTGGTGGGGAAATGTGTGG + Intergenic
989524220 5:42434490-42434512 TTTATAGGTGAGGAAATGGGAGG + Intronic
989971273 5:50527402-50527424 TGATTTGGGGAGGGGATGGGTGG - Intergenic
990671481 5:58135336-58135358 TGTCTTGGGGAGGAAAACAGAGG - Intergenic
991406038 5:66301961-66301983 GGTAATGGGGAGAAAATGGAAGG + Intergenic
991985458 5:72281329-72281351 TTTATGAGGGAGGAAATGGATGG + Intronic
992636520 5:78730282-78730304 TGGATAGGGGAGGGAAAGGGGGG - Intronic
992750281 5:79854877-79854899 TGTTTTGGGGCTGAACTGGGAGG + Intergenic
993903968 5:93603648-93603670 CTTATTTGGGAGGAAATAGGGGG - Intergenic
995185460 5:109266876-109266898 TGTGTTGGGGAAGAAGAGGGAGG + Intergenic
998412920 5:141924715-141924737 TGACTAGGGGAGGAAATGAGTGG - Intronic
998479239 5:142448090-142448112 AGTGTTGGTGAGGATATGGGAGG - Intergenic
998687161 5:144541399-144541421 TTTATTGGAGAGGCAATGGAAGG + Intergenic
998761084 5:145433232-145433254 TGTATTGGGCAGGGATAGGGAGG - Intergenic
1001961712 5:175883719-175883741 TGCACTGGGGAGAAAACGGGAGG + Exonic
1002303333 5:178269693-178269715 TGGATTGGTGGGGGAATGGGTGG - Intronic
1002578417 5:180191991-180192013 TGTGTTGTGGAGAAAGTGGGTGG - Intronic
1003984923 6:11426015-11426037 TGTGGTGGGGAGGCAATGAGGGG - Intergenic
1004069809 6:12288142-12288164 AATATTGGGGAGGGCATGGGCGG + Intergenic
1004967273 6:20867897-20867919 TGTAGAGGTTAGGAAATGGGAGG + Intronic
1005336937 6:24806460-24806482 TGTATTTAGGAGAAGATGGGCGG - Exonic
1006098907 6:31673507-31673529 TTTATTGTGGAGGAAAATGGGGG - Exonic
1009891541 6:69689949-69689971 TGTCTTAGGGTGGGAATGGGAGG - Intronic
1010106447 6:72174959-72174981 TGTATGTGGGTGGGAATGGGTGG - Intronic
1011765443 6:90614898-90614920 TGTATCGGGGAGGAAATGCATGG + Intergenic
1011837464 6:91451132-91451154 ATGATTGGGGAGGATATGGGAGG - Intergenic
1012548068 6:100441941-100441963 TGTATAGGGGTGGAAGTGGAAGG - Intronic
1013050985 6:106534820-106534842 TGTGTAGGGGTGGAAGTGGGGGG + Intronic
1013119193 6:107126370-107126392 TGTATTGGAGAAGAAATGGGTGG - Intergenic
1013834211 6:114313637-114313659 TTTATTGGGGAGGAGGTGGTGGG + Intronic
1015875320 6:137816687-137816709 TTTATTGGGGAGGATGGGGGTGG + Intergenic
1016402754 6:143698648-143698670 TGTAGTGAGTAGGAAATGTGGGG - Intronic
1017353750 6:153477166-153477188 TTTATCAGGGAGGAAAAGGGAGG - Intergenic
1017444249 6:154493060-154493082 TGTTTTGGGGAGCTATTGGGGGG - Intronic
1022192850 7:28033745-28033767 TTTTTTGGGGGGGCAATGGGAGG + Intronic
1023029243 7:36078726-36078748 GGGTTTGGGGAGGACATGGGGGG - Intergenic
1023514317 7:40985471-40985493 GGTGTTGGGGAGTAAATGTGGGG + Intergenic
1024932797 7:54681264-54681286 TGGATTTTGGAGGGAATGGGAGG - Intergenic
1027587317 7:80074729-80074751 GGGATTGGGGAGGAGATGAGGGG + Intergenic
1027587326 7:80074751-80074773 GGGATTGGGGAGGAGATGAGGGG + Intergenic
1028594571 7:92534080-92534102 TAAAGTGGGGAGAAAATGGGAGG + Intronic
1028790395 7:94847387-94847409 GTCATTGGAGAGGAAATGGGAGG - Intergenic
1029177571 7:98675674-98675696 GGATTTGGGGAGGAAATTGGAGG + Intergenic
1029390459 7:100271279-100271301 GGAATTGGGGGGGAAACGGGGGG - Intronic
1030341495 7:108385782-108385804 TGTATTGGAGAGAATATGGAAGG + Intronic
1031301017 7:120060774-120060796 TGTAACAGGGAGGACATGGGAGG - Intergenic
1032206410 7:129869725-129869747 AGTATTTGGGAGGACAGGGGTGG + Intronic
1032344186 7:131104982-131105004 TGTATAGGGGAGGAAAATCGTGG - Intergenic
1032734136 7:134674396-134674418 GGAATAGGGGAGGAACTGGGGGG - Intronic
1033109957 7:138564882-138564904 TGTAACTGGGAGGAAATGAGAGG - Intronic
1033979245 7:147143219-147143241 TGTAATCAGGAGGAAATGTGTGG - Intronic
1035470393 7:159105551-159105573 TGTACTGGGGAGGAGTGGGGTGG + Intronic
1035533971 8:377194-377216 TGAATTTGGGTAGAAATGGGTGG - Intergenic
1036562888 8:9912707-9912729 TGGGTTGGGGCGGAAAAGGGAGG + Intergenic
1037491727 8:19402628-19402650 TGTCTTGGGCAGGCAAAGGGGGG + Intergenic
1038446887 8:27610730-27610752 TTTATTCCTGAGGAAATGGGGGG + Intronic
1038596504 8:28890763-28890785 GGTTTTGGGGAGGAAGTGAGCGG + Exonic
1040517091 8:48144237-48144259 TGTAATGAGGAGAAAGTGGGAGG + Intergenic
1040876527 8:52158204-52158226 TCAATTGGGGAGGAAAGGAGAGG + Intronic
1041599812 8:59703749-59703771 TGTATTGGAGCGGGAGTGGGTGG - Intergenic
1042782372 8:72506120-72506142 GGGATGTGGGAGGAAATGGGAGG - Intergenic
1043376776 8:79658426-79658448 TGTATTGGGAAAGACATGGTTGG - Intronic
1045029223 8:98118833-98118855 TGGATTGGAGAGGGAAGGGGTGG + Intronic
1045476932 8:102561130-102561152 AGTATGGAGGAGGGAATGGGAGG - Intergenic
1046297109 8:112234113-112234135 TGTGTGGGGGAGGGTATGGGTGG - Intronic
1046376776 8:113393497-113393519 TGTATTGAAGTGGAAATGGCAGG - Intronic
1047058681 8:121197287-121197309 TGTATTTGGGAGGAAATCTCTGG - Intergenic
1047521814 8:125600754-125600776 TGTCTTGGGGAGCAGAAGGGAGG + Intergenic
1048251359 8:132869297-132869319 TATATTGGGAAGCACATGGGTGG - Intronic
1049265970 8:141668088-141668110 TGTGTTGGGGGGGATCTGGGTGG + Intergenic
1049291954 8:141808124-141808146 TGTGTTGGGGAGGAAGTGTGGGG + Intergenic
1049315993 8:141967999-141968021 TATGTTGGGGTGGAAGTGGGAGG + Intergenic
1050820779 9:9877336-9877358 TGTCATGGGGAGGATAAGGGAGG + Intronic
1050823034 9:9907039-9907061 TGTGTTGGGGAGAGTATGGGGGG - Intronic
1050867333 9:10519241-10519263 TTTTTTGTGGAGGAAATGAGAGG - Intronic
1052833447 9:33233754-33233776 TGTAGGGGGCAGGCAATGGGAGG - Intronic
1055496183 9:76857812-76857834 TGTCTGGGGCAGGTAATGGGAGG + Intronic
1056159490 9:83874257-83874279 TTTATAGATGAGGAAATGGGTGG + Intronic
1056494378 9:87141631-87141653 TTTATTTGGGAGGTGATGGGTGG + Intergenic
1057279823 9:93701499-93701521 GGTAGAGGGGAGGAAACGGGAGG + Intergenic
1057920805 9:99095125-99095147 TCTTCTGTGGAGGAAATGGGAGG - Intergenic
1058615962 9:106827933-106827955 TGAATTGGGGAGGGAAGGGAAGG + Intergenic
1059858953 9:118435362-118435384 AGTATTGGGGAGTAAATGCATGG - Intergenic
1060702517 9:125770022-125770044 TGTATAGAAGAGGAAATGGAAGG + Intronic
1186502195 X:10060419-10060441 TGTGTTGGGGAGGGGGTGGGGGG + Intronic
1186884308 X:13897817-13897839 CTTATTGGGCAGGAATTGGGTGG - Intronic
1187306311 X:18098523-18098545 TATATTGGGGAGGAGGTGAGGGG - Intergenic
1187493240 X:19772555-19772577 TGGAACGGAGAGGAAATGGGGGG - Intronic
1189612805 X:42754807-42754829 TGTAGTGTGAAGGAAATTGGAGG - Intergenic
1189828759 X:44948582-44948604 TGTACTGTGAAGGAAATGGTGGG + Intronic
1190388547 X:49909528-49909550 GTTGATGGGGAGGAAATGGGTGG - Intergenic
1190429460 X:50365345-50365367 TGAATGGTGGTGGAAATGGGGGG - Intergenic
1190681846 X:52832806-52832828 TCTATTTGGGAGGAAAGGTGTGG - Intergenic
1191127815 X:56975938-56975960 TTTATAGGGTAGTAAATGGGAGG + Intergenic
1192320364 X:70085784-70085806 TGTCTTGCGGGGGGAATGGGGGG + Intergenic
1193232272 X:79061992-79062014 TGTATTTGGTGGGAGATGGGGGG + Intergenic
1193308728 X:79979899-79979921 TGTTTTGGGGGGGACATGGATGG - Intergenic
1194091693 X:89586231-89586253 CGTAACTGGGAGGAAATGGGAGG - Intergenic
1194320719 X:92442370-92442392 TGTGTTGTGGGGGAACTGGGTGG + Intronic
1194792327 X:98165882-98165904 TGTATTGGGGAGGGGGTGTGAGG + Intergenic
1195024363 X:100861444-100861466 TATATTGAGGAGTAAATGGAAGG - Intronic
1196166605 X:112541853-112541875 TTTGTTGGGGAGGAGTTGGGGGG - Intergenic
1198428798 X:136545801-136545823 TGTATATGGGTGGAAATGTGTGG + Intronic
1198671805 X:139089161-139089183 TGTGTTGGAGAGAAAGTGGGAGG + Intronic
1199988251 X:152968037-152968059 TACATTGGGGAGGAAAAGGAAGG + Intronic
1200424118 Y:3003654-3003676 TGTAAATGGGAGGAAATGGGAGG + Intergenic
1200444329 Y:3242294-3242316 CGTAACTGGGAGGAAATGGGAGG - Intergenic
1201070500 Y:10143629-10143651 GGTATTGGTGAGTATATGGGAGG - Intergenic
1202622894 Y:56831056-56831078 TGCATTGGAGAGGAAAGGAGTGG - Intergenic