ID: 1164288323

View in Genome Browser
Species Human (GRCh38)
Location 19:23842482-23842504
Sequence AGAATTGTTAATTTTACTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 623
Summary {0: 2, 1: 1, 2: 0, 3: 58, 4: 562}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164288323_1164288327 22 Left 1164288323 19:23842482-23842504 CCTAGAGTAAAATTAACAATTCT 0: 2
1: 1
2: 0
3: 58
4: 562
Right 1164288327 19:23842527-23842549 TGTGTGTTTTTTTTTTTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164288323 Original CRISPR AGAATTGTTAATTTTACTCT AGG (reversed) Intergenic
900032971 1:384599-384621 GGGATTTTTAATTTCACTCTGGG - Intergenic
900053812 1:614489-614511 GGGATTTTTAATTTCACTCTGGG - Intergenic
902137163 1:14319129-14319151 GAAATTGTTAATTTTACATTTGG + Intergenic
903964428 1:27078054-27078076 AGAATTGTTACTTTAACACTTGG + Intergenic
905262169 1:36727576-36727598 GGGATTATTAATTTTGCTCTTGG + Intergenic
905417195 1:37812104-37812126 AAAATGGTTAAGTTTACTATGGG + Exonic
905710758 1:40100391-40100413 AAAATTGTTAAAGTAACTCTGGG - Intergenic
905712121 1:40114268-40114290 AGAATTATTTATTTTCCTTTGGG - Intergenic
905932170 1:41796663-41796685 AGCATTTTTTATTTTATTCTTGG + Intronic
906023844 1:42656290-42656312 ATAAATGTTAATATTGCTCTAGG + Intergenic
906833279 1:49057464-49057486 GAAATTGTGAATTTTAATCTAGG - Intronic
906890806 1:49711247-49711269 ACAATTTTTAATTTTTTTCTTGG - Intronic
907085008 1:51663652-51663674 AGAATTCTTAACTTTAATGTAGG - Intronic
908225498 1:62052195-62052217 AGAGTTGTTCATTTTACTTCAGG + Intronic
908734661 1:67263380-67263402 AGAAATCCTAATTTTAGTCTGGG - Intergenic
909007629 1:70295648-70295670 AGAATTGTTAAATCAAATCTCGG - Intronic
909347879 1:74613913-74613935 AAAATTGTTAACTTTATTATTGG - Intronic
909507863 1:76414827-76414849 AGAATTGTTGATTTTTATGTAGG - Intronic
909629341 1:77755295-77755317 AGAATTGATAATTTTTCTTATGG - Intronic
910017145 1:82539616-82539638 CGAATTGCTAATTTTGGTCTAGG + Intergenic
910329506 1:86054798-86054820 AGAATTATTTATTTTTCTTTGGG - Intronic
911354831 1:96803207-96803229 AGAATTCTTAATTTTAAAATTGG + Intronic
911434774 1:97843752-97843774 AGTATTGTAAATTTTTTTCTAGG - Intronic
911578436 1:99605742-99605764 AGATTTGTTAATTTAAATGTAGG + Intergenic
911760691 1:101611411-101611433 AGAATTATTTATATTCCTCTGGG + Intergenic
911863529 1:102986893-102986915 AGAGATTTTAATTTTAATCTGGG - Intronic
911933645 1:103937962-103937984 AGAATTTCTACTTTCACTCTGGG - Intergenic
912158540 1:106952473-106952495 AGAATTGTAAATTTAAATTTAGG - Intergenic
913395828 1:118370743-118370765 AGAATGGTTTATTTTACTTTGGG + Intergenic
913482112 1:119298724-119298746 AGAGTTGTTACTTTTACTTTTGG + Intergenic
913677816 1:121158507-121158529 AGAAATGTTGACTTTGCTCTTGG + Intergenic
914029650 1:143946136-143946158 AGAAATGTTGACTTTGCTCTTGG + Intronic
914159799 1:145121814-145121836 AGAAATGTTGACTTTGCTCTTGG - Intergenic
914732682 1:150385779-150385801 TGAACTTTTAATTTTTCTCTTGG + Intronic
914772602 1:150703030-150703052 GGAATGGTTAATTTTACTGAAGG - Intronic
915053816 1:153106481-153106503 AGAATGGTTTATATTCCTCTAGG - Intergenic
916643741 1:166761223-166761245 AGAAATGTTAATTTGACATTTGG - Intergenic
916724879 1:167514396-167514418 AGAATTGTTGAATGCACTCTGGG - Intronic
916968176 1:169976639-169976661 AGAAATGTTAATATTAATATGGG - Intronic
917177986 1:172260889-172260911 AGTATTTTTAATTTTTCCCTAGG + Intronic
917272554 1:173294110-173294132 AGAATGGTTTATTTTTCTTTGGG - Intergenic
918568202 1:185955279-185955301 AGGAGTGTAAATTTTATTCTGGG - Intronic
918877690 1:190070709-190070731 AGAATGCTTTATATTACTCTAGG + Intergenic
919127431 1:193412646-193412668 AGAATTGCTCATTTTACACCTGG + Intergenic
919157466 1:193785426-193785448 AGAATTGTTAGGTTTATTCTGGG - Intergenic
919261552 1:195201648-195201670 AGAATTTTTAATTATAGTCTTGG + Intergenic
919275417 1:195408973-195408995 AGAATTGTTTATTTTCCTTGGGG - Intergenic
920028468 1:203019436-203019458 ATAATTGTTAATTTTCTTATGGG + Intronic
920465121 1:206177017-206177039 AGAAATGTTGACTTTGCTCTTGG + Intergenic
920771712 1:208892731-208892753 AGAATTGTGATTTTCACCCTTGG + Intergenic
921867356 1:220099755-220099777 AGATTGGTTCACTTTACTCTGGG - Intronic
922027841 1:221768506-221768528 AGAATTATTTATTTTCCTTTGGG + Intergenic
922310982 1:224390550-224390572 GGAGTTGTTAATTTTCCTTTTGG + Intronic
923085380 1:230699281-230699303 AGAATGGTTTATTTTCCTCTGGG + Intergenic
923368134 1:233283904-233283926 AAAATTGGTAATTTTACAATAGG + Intronic
923425473 1:233864612-233864634 AGAATGATTTATTTTCCTCTGGG - Intergenic
923549001 1:234946489-234946511 AGACTTGTCAATATTACTCTGGG + Intergenic
923556102 1:235001595-235001617 AGAATAACTAATTTTACTCGGGG - Intergenic
924336535 1:242991617-242991639 GGGATTTTTAATTTCACTCTGGG - Intergenic
924617178 1:245621787-245621809 AGAATTGTGAATTTCACACATGG - Intronic
924624976 1:245689929-245689951 AGACTTGTTAATTGGAGTCTTGG + Intronic
1063978708 10:11437033-11437055 AGAAATGTGAATTTACCTCTGGG + Intergenic
1065049441 10:21776453-21776475 TCATTTGTTAAATTTACTCTTGG + Intronic
1065103932 10:22360664-22360686 TGAATTGTTATTTTTAGTATTGG + Intronic
1065939332 10:30549871-30549893 AAAATTGTATATTTAACTCTTGG - Intergenic
1066131014 10:32394035-32394057 AGAATAGTAATTTTTGCTCTTGG - Intergenic
1067530490 10:47067895-47067917 AGAATTATTTATATTGCTCTGGG + Intergenic
1067969036 10:50948311-50948333 TGAATTGGTTATTTTAGTCTTGG + Intergenic
1067994530 10:51256699-51256721 AGAAAAGTTAGATTTACTCTAGG + Intronic
1068562374 10:58529635-58529657 AGACATGTTTATTTTAATCTGGG + Intronic
1068731313 10:60361459-60361481 AGAATTGTGAATTTAATTTTCGG + Intronic
1069358760 10:67617589-67617611 AGAATGATTTATATTACTCTGGG + Intronic
1070071212 10:73091460-73091482 AGAAATGTTTATTTTAGTCTAGG - Intronic
1070901270 10:80030854-80030876 AGAATTATTTATTTTCCTTTAGG - Intergenic
1071383364 10:85094652-85094674 AGATTTGTTATTTTTGCTCAAGG + Intergenic
1071802283 10:89076932-89076954 AGAATTGTTTCTTTTTCTCTTGG - Intergenic
1072224728 10:93358456-93358478 AGAATGGTTTATATTCCTCTGGG - Intronic
1072942190 10:99775694-99775716 AAAAATGTTAATATTATTCTTGG + Intergenic
1073863693 10:107776208-107776230 AGAATGATTTATATTACTCTGGG - Intergenic
1073934046 10:108609274-108609296 AGAATGGTTGATATTCCTCTGGG - Intergenic
1075582371 10:123631648-123631670 AGAATTGTTATTTCTTCTCAGGG - Intergenic
1075893541 10:125975330-125975352 AGAATGGTTTATATTCCTCTGGG + Intronic
1076071121 10:127490522-127490544 AGAAAATTTAATTCTACTCTTGG + Intergenic
1077770390 11:5211858-5211880 AGAATGGTTTATTTTCCTTTAGG + Intergenic
1078039232 11:7842852-7842874 AGAATGGTTTATTTTCCTTTGGG - Intergenic
1079199822 11:18367096-18367118 AGAACTGTTCATTTTATTTTAGG + Intergenic
1079253133 11:18802347-18802369 GTAATTGTTAAGTTTTCTCTGGG + Intergenic
1079284936 11:19120033-19120055 AGAATTGTTAAAGTTACAGTGGG - Intronic
1079636801 11:22752596-22752618 ATATTGGCTAATTTTACTCTGGG + Intronic
1081228830 11:40559502-40559524 AGAATTATTTATATTCCTCTGGG + Intronic
1081387841 11:42493293-42493315 AGAATGGTTGATTTTTGTCTTGG - Intergenic
1082114489 11:48313619-48313641 AGAATGATTAATATTCCTCTGGG - Intergenic
1083046502 11:59741056-59741078 AGAATTGTGTATTTTCCTGTTGG + Intronic
1083915076 11:65737075-65737097 AGAACTCATCATTTTACTCTAGG + Intergenic
1085487561 11:76880280-76880302 AAAGTTGTAAATTTTCCTCTTGG + Intronic
1086206955 11:84269927-84269949 AGAAGTTTTAAGTTTACTTTTGG + Intronic
1086702131 11:89910839-89910861 TTAATTGTTAATTTTTGTCTTGG + Intergenic
1086751867 11:90506347-90506369 AAAATTGTTATTTTTCTTCTTGG - Intergenic
1087689328 11:101301391-101301413 AAATTTGTAAATTTTTCTCTAGG - Intergenic
1088112087 11:106273809-106273831 AGAATGATTTATTTTCCTCTGGG + Intergenic
1088122306 11:106384817-106384839 CGAATTTTTAAATTTACTTTAGG - Intergenic
1088179717 11:107095054-107095076 AGAATTGTGATTTTTCCTGTTGG - Intergenic
1088567588 11:111188892-111188914 AGAATGATTTATTTTCCTCTGGG - Intergenic
1089485231 11:118840380-118840402 AAAATTGGGAATTTTAATCTGGG - Intergenic
1090193591 11:124796138-124796160 TGAATTAATAATTTAACTCTTGG - Intronic
1093472382 12:19516645-19516667 AGTCTTGTTGATTTTATTCTTGG + Intronic
1094308761 12:29053319-29053341 AAAAAAGTGAATTTTACTCTAGG + Intergenic
1094457742 12:30657350-30657372 AAAATTGTTAATGTTGCACTTGG - Intronic
1095794559 12:46203791-46203813 AGAATACTTATTTTTACTCAAGG + Intronic
1096036931 12:48480713-48480735 AGAATGATTAATTTTCCTTTGGG - Intergenic
1096042591 12:48531162-48531184 AGAATTATTCATTTTATTCCAGG + Intergenic
1097571960 12:61344955-61344977 AGGATTGTAAATTTTTCTTTGGG + Intergenic
1098247395 12:68534746-68534768 AAAATTATTAATTTTCTTCTAGG - Intergenic
1098492161 12:71094099-71094121 ACTATTGTTAATTTTCATCTAGG - Intronic
1098789629 12:74805344-74805366 AGAATTATTTATATTTCTCTGGG - Intergenic
1098810367 12:75081024-75081046 AAAATTGTAAATTTTATCCTCGG - Intronic
1099095545 12:78370727-78370749 GGTATTTTAAATTTTACTCTAGG - Intergenic
1099341919 12:81448265-81448287 TGAATTGTTAACTTTAAGCTGGG - Intronic
1099472542 12:83069180-83069202 ATAATGATTTATTTTACTCTGGG + Intronic
1099606568 12:84809345-84809367 AGTAATGTTTATTTTACACTTGG + Intergenic
1099818066 12:87674043-87674065 AGAACTGCTAATTTTAACCTGGG - Intergenic
1099958920 12:89378370-89378392 AGCGTTGTTTGTTTTACTCTAGG + Intergenic
1100376907 12:94025565-94025587 AGATTTCTGAATTTCACTCTTGG + Intergenic
1100496457 12:95129650-95129672 AAACTTGTAAATTTTACTCAAGG - Intronic
1100527395 12:95432497-95432519 AGAAGTGTGGATTTTATTCTCGG + Intergenic
1101512094 12:105402639-105402661 AGTAGTGTTAATACTACTCTTGG - Intergenic
1101847930 12:108378258-108378280 AGAATGATTTATTTTCCTCTGGG - Intergenic
1101961541 12:109254491-109254513 AGAAATGGAGATTTTACTCTAGG + Intronic
1102127522 12:110496534-110496556 AGAATGCTTGATTTCACTCTTGG - Intronic
1103223355 12:119265476-119265498 AGAATAGTTTATTTTCCTTTGGG - Intergenic
1106647724 13:31654656-31654678 AGAATTGTTAACTTTATGCCAGG + Intergenic
1106684767 13:32046720-32046742 AGAATTGTTGCTCTTAATCTTGG + Intronic
1107269573 13:38599488-38599510 AGAATGATTAATTTTCCTTTGGG - Intergenic
1107383249 13:39879023-39879045 GCAATTGTGAATTTTAATCTTGG - Intergenic
1108399153 13:50021711-50021733 CTAATGCTTAATTTTACTCTTGG + Intergenic
1108754984 13:53489100-53489122 AGATTTTTTCATTTCACTCTAGG - Intergenic
1109380601 13:61554410-61554432 ATAATTATTCATTTTACTATTGG - Intergenic
1109485602 13:63015277-63015299 AGAATTATTTATATTCCTCTGGG + Intergenic
1109585884 13:64403227-64403249 AGAATGGCTTATTTTTCTCTTGG + Intergenic
1110115623 13:71812594-71812616 GGAACTGTTAATTTTCCTGTTGG - Intronic
1110340132 13:74380429-74380451 AGAACTATTAATTTTAATATTGG - Intergenic
1111148887 13:84222089-84222111 AAAATGGTTTATTTTCCTCTGGG - Intergenic
1111392110 13:87609671-87609693 ATAAGTTTTAATTTTACACTGGG - Intergenic
1112082770 13:95992925-95992947 AGAATTATTTATTTTTCTTTGGG - Intronic
1112085219 13:96024354-96024376 AGAATTTTTAATTAAATTCTAGG - Intronic
1112320295 13:98400552-98400574 AGATTTGTTAATTTAAGACTGGG - Intronic
1113038681 13:106080519-106080541 AGAAGTCTTAATTTTACTATAGG - Intergenic
1114421209 14:22584779-22584801 AAAAGTTTTAATTTTACTTTGGG + Intronic
1114589647 14:23849308-23849330 AGAATGTTTATTTTTGCTCTTGG - Intergenic
1114667135 14:24385250-24385272 ATAAAGGTTTATTTTACTCTTGG - Intergenic
1115213848 14:30995230-30995252 AGAATTGTAAAGTTAACTTTTGG - Intronic
1116010483 14:39345734-39345756 AGAATTGCATATTTTACTATAGG - Intronic
1116043881 14:39719242-39719264 AGAGTTATTCATTTTACCCTAGG + Intergenic
1116271974 14:42783125-42783147 TTAATTGGTCATTTTACTCTTGG - Intergenic
1116489995 14:45494021-45494043 ATAAACGTTAATTTTACTTTTGG + Intergenic
1116528563 14:45937012-45937034 AGAATGGTTTATTTTCCTTTGGG - Intergenic
1117573381 14:57072319-57072341 AGAATTGTTCAGTTTACTTCTGG - Intergenic
1117847677 14:59929583-59929605 AGAATGGTTTATATTACTTTGGG - Intronic
1117854781 14:60017176-60017198 GGAATTTTTAATTTTAGGCTGGG - Intronic
1117982631 14:61357017-61357039 TGAAGTCTTTATTTTACTCTTGG - Intronic
1118829090 14:69412452-69412474 AGAATTGATAGTTTCACTCAAGG - Intronic
1120293786 14:82612029-82612051 CAAAATGTTGATTTTACTCTTGG + Intergenic
1120307383 14:82787883-82787905 AGAATTTTTAAGTGTATTCTTGG + Intergenic
1120347339 14:83307632-83307654 AGAATGGTTAATTTTCATTTAGG - Intergenic
1121381122 14:93468211-93468233 ATAATAGTTATTTTTAATCTGGG + Intronic
1121502826 14:94451897-94451919 ATAGTTCTTAATTTTCCTCTGGG - Intronic
1121848202 14:97193964-97193986 AGAAATTTTAATTTTCATCTTGG + Intergenic
1202890885 14_KI270722v1_random:156369-156391 AGAATGTTTACTTTTGCTCTTGG - Intergenic
1123738130 15:23205646-23205668 ATAATTGATCATTTTACTTTTGG + Intergenic
1124289340 15:28434310-28434332 ATAATTGATCATTTTACTTTTGG + Intergenic
1124293882 15:28482998-28483020 ATAATTGATCATTTTACTTTTGG - Intergenic
1124476154 15:30036867-30036889 ATAATTGGGGATTTTACTCTAGG - Intergenic
1124572831 15:30881951-30881973 AAAATTGTTGATCTTGCTCTAGG - Intergenic
1125069568 15:35536313-35536335 AGAAATATTAATTTTACTATAGG - Intronic
1125214290 15:37252479-37252501 AGAAGTCTTATTTTTACTCCTGG + Intergenic
1125705708 15:41733832-41733854 AGAATTTTTAAAATTACTCCAGG - Intronic
1126146758 15:45481579-45481601 AGCATTATTAATTTTGCACTGGG - Exonic
1126530720 15:49707948-49707970 AGAATGGTTTATATTCCTCTGGG + Intergenic
1126949810 15:53868643-53868665 AGGGTTGTTAATTTTGCTCTTGG + Intergenic
1128855606 15:71011264-71011286 AGAATGGTTATTTTTACTGTGGG + Intronic
1128945605 15:71818128-71818150 AGAAATGTTGATTTTGATCTGGG + Exonic
1129612070 15:77069099-77069121 AGAAATGTAAATATTATTCTGGG + Intronic
1129863369 15:78881696-78881718 AGACTTGTAATTTTTACTATGGG + Intronic
1130748429 15:86682293-86682315 AGAAGTGCTAATTTTAGGCTGGG + Intronic
1130780084 15:87027424-87027446 AGAATTATTTATATTCCTCTGGG - Intronic
1131587591 15:93712963-93712985 AGAATTTTTTATTTTATTGTTGG - Intergenic
1133005167 16:2876559-2876581 AGAATTTTAAATTTTATCCTTGG - Intergenic
1133310443 16:4842654-4842676 ATAATTGTTAATTCTAGGCTGGG - Intronic
1133915296 16:10104113-10104135 AGGGTTGTTATTTTTTCTCTAGG + Intronic
1134341066 16:13346712-13346734 AGAATGGTTTATTTTCCTTTGGG - Intergenic
1134865689 16:17604803-17604825 AGAAGACTGAATTTTACTCTTGG - Intergenic
1135474485 16:22762324-22762346 AGAATTTTGGATTTTATTCTAGG - Intergenic
1136061215 16:27727988-27728010 AAAATTGTTTCTTTTACACTTGG + Intronic
1138127884 16:54453780-54453802 AGAAGTGTAAATTTTCCTGTTGG + Intergenic
1138925732 16:61588943-61588965 AGTATTGTTTATTTTACATTAGG + Intergenic
1140276683 16:73515199-73515221 AGACTTGTTAAGTTTCCACTGGG - Intergenic
1140975895 16:80059876-80059898 ATAATTATTATTTTTACTCGTGG + Intergenic
1144036173 17:11367878-11367900 CCAATTGTTTATTTTGCTCTGGG + Intronic
1144604788 17:16655525-16655547 AGAATTTTTAAATGTCCTCTTGG + Intergenic
1146251789 17:31352457-31352479 AAAATAGATATTTTTACTCTTGG + Intronic
1146377547 17:32304735-32304757 AGAAGTCTGAATTTTACTTTGGG + Intronic
1146601880 17:34224402-34224424 AGAGTTCTCAATTTTACTCTGGG - Intergenic
1147875932 17:43620438-43620460 ATAAGTCTTAATTTTGCTCTTGG - Intergenic
1148040680 17:44704251-44704273 AGAATGGTTTATTTTCCTTTGGG + Intergenic
1150203854 17:63385444-63385466 AGAATTCTAAATGTTACTCAGGG - Intronic
1150542121 17:66112555-66112577 TGAATTGGTACTTTTACTCAGGG + Intronic
1150859998 17:68791420-68791442 AGAAGTATTTATTTTCCTCTGGG - Intergenic
1150921182 17:69485159-69485181 TGAATTGTTAATTTTAGAGTTGG - Intronic
1150998825 17:70350620-70350642 AGAATTATTTATATTCCTCTGGG - Intergenic
1151079018 17:71306877-71306899 AGAATTGTGATATTTACTGTCGG - Intergenic
1155060119 18:22220943-22220965 AGAATGGTTTATATTCCTCTGGG + Intergenic
1155204323 18:23544627-23544649 AGAATTGTACATTCAACTCTAGG - Intronic
1155718910 18:28985897-28985919 AGAATTCCTATTTTTACTTTTGG - Intergenic
1155986342 18:32234390-32234412 AGAATTTTATATTTTACTCTAGG + Intronic
1156668007 18:39431798-39431820 AGATTAGTTAATATTACTCCAGG + Intergenic
1156837487 18:41571764-41571786 TGAATTATTAATTTTATTATGGG - Intergenic
1156846323 18:41669663-41669685 TGAATTGGCAAATTTACTCTAGG - Intergenic
1156991143 18:43409105-43409127 TCAATTTTTAATTTTATTCTAGG - Intergenic
1157071267 18:44411552-44411574 AGAATCTTTAAATTTAATCTAGG - Intergenic
1157454934 18:47817787-47817809 AGAATGTTTATTTTTGCTCTTGG - Exonic
1160047127 18:75397119-75397141 AGTATTGTTATTATTACTATTGG - Intergenic
1160175567 18:76591428-76591450 AAAATGGTTAATTTTACGATAGG + Intergenic
1160360971 18:78277982-78278004 AGAATGATTTATTTTCCTCTTGG + Intergenic
1161518548 19:4710696-4710718 AGAAGTGTTATTATTACTCAGGG + Intronic
1163873906 19:19849763-19849785 AGAATTTTTAATTTGACTTAAGG + Intergenic
1163880338 19:19915215-19915237 GGAATTTTTAATTTTACTTAAGG - Intronic
1163984619 19:20933913-20933935 AGCATTTTTAATTTTACTCAAGG - Intronic
1164021490 19:21310674-21310696 AGAATTTTTAATTTGACTCAAGG + Intronic
1164076049 19:21819279-21819301 AGAATTTATAATTTGACTCAAGG + Intronic
1164086827 19:21910610-21910632 AGAATTGTTAATCTCACCCCTGG + Intergenic
1164094037 19:21988952-21988974 AGAATTTTTAATTTGACTCAAGG + Intronic
1164102756 19:22072734-22072756 AGAATTTTTAATGTCACTCAAGG - Intronic
1164134678 19:22403561-22403583 AGAATTTTTAATTTGACTCAAGG + Intronic
1164164136 19:22653236-22653258 AGAATTTTTAATTTGACTCAAGG - Intronic
1164175387 19:22769374-22769396 AGAATTTTTAATTTGACTCAAGG + Intronic
1164184231 19:22848184-22848206 AGAATTTTTAATTTGACTGAAGG - Intergenic
1164197934 19:22988498-22988520 AGAATTTTTAATTTGACTCAAGG + Intronic
1164236629 19:23342941-23342963 AGAATTGTTAATTTTACTCTAGG + Intronic
1164239747 19:23374811-23374833 AGAATTTTTCATTTGACTCAAGG + Intronic
1164288323 19:23842482-23842504 AGAATTGTTAATTTTACTCTAGG - Intergenic
1164296908 19:23919304-23919326 AGAATTTTTCATTTGACTCAAGG - Intronic
1164317508 19:24105871-24105893 AGAATTTTTCATTTGACTCAAGG - Intronic
1164320568 19:24140948-24140970 AGAATGGTTAATTTTACTCTAGG - Intergenic
1167991236 19:53362722-53362744 AGACTTATTATTTTTAGTCTTGG - Intergenic
1202666306 1_KI270708v1_random:123210-123232 AGAATGTTTACTTTTGCTCTTGG - Intergenic
927300529 2:21507081-21507103 AGAATGTTTATTTTTGCTCTTGG - Intergenic
928642810 2:33318402-33318424 AGAATTGTATGTTTTACCCTTGG - Intronic
930342654 2:50136247-50136269 GGAATTTTTATTTTTTCTCTTGG - Intronic
930770575 2:55126682-55126704 AGAATCGTTTATATTCCTCTGGG - Intergenic
931677330 2:64710429-64710451 AGAATTATTAATTTTTTTCTTGG + Intronic
931845312 2:66197828-66197850 AGAATGATTTATTTTCCTCTGGG - Intergenic
933333375 2:80922890-80922912 ATAATTGTTTATGTTTCTCTTGG - Intergenic
933466813 2:82661976-82661998 TGAATTCCTAATTTTGCTCTTGG - Intergenic
933515958 2:83302111-83302133 AGAATGATTAATTTTCCTTTGGG + Intergenic
936862803 2:117037837-117037859 AGAATAATTTATTTTCCTCTGGG - Intergenic
937202228 2:120211105-120211127 AGAATGATTAATATTACTGTGGG - Intergenic
937756977 2:125551514-125551536 AGAATAATTAATTTTCCTTTGGG - Intergenic
938684032 2:133719659-133719681 AGTATTGTTATTTCTCCTCTGGG - Intergenic
938735618 2:134183912-134183934 AGAACTGTTCATTTTCGTCTCGG - Intronic
939111111 2:138008473-138008495 AGAATGATTAATATTCCTCTGGG + Intronic
939239908 2:139544167-139544189 AGAATGGTTATTTTTGCTCTTGG - Intergenic
939427927 2:142064562-142064584 AGAAGTGTGCATTTTACTCATGG - Intronic
939588764 2:144037270-144037292 AAAATGGTTAATTTTACACTAGG + Intronic
939863049 2:147441967-147441989 ACAATTGGTAATTTTTTTCTAGG + Intergenic
941002358 2:160215148-160215170 AAAATGTTTAATTTCACTCTGGG - Intronic
941581901 2:167308091-167308113 AGAATTGTTAATCTTTTTATAGG + Intergenic
941825096 2:169886168-169886190 AAAAAAGTTAATTTTACTTTTGG + Intronic
942028757 2:171937233-171937255 TGATTTCTTAATTTTACTTTTGG + Intronic
943388675 2:187233951-187233973 AGAAATGATAATTATACTTTAGG + Intergenic
943781931 2:191833901-191833923 AGAAGACTTAATTTTACTCAGGG - Intergenic
944521772 2:200577510-200577532 AGTTTTGATAATTTTACTGTGGG - Intronic
945343714 2:208687615-208687637 AGAATTATTAATATTCCTTTGGG + Intronic
945364199 2:208930787-208930809 ATAATGGTTTATTTTCCTCTGGG - Intergenic
945912228 2:215662467-215662489 CGAATTATTACTTTAACTCTGGG - Intergenic
946641290 2:221786076-221786098 GGAATTGCTAATTATACTTTTGG - Intergenic
946649562 2:221876154-221876176 AGAATGATTCATTTTCCTCTGGG + Intergenic
946729329 2:222693056-222693078 TGATATGCTAATTTTACTCTGGG - Intronic
946963500 2:225010432-225010454 AGAATTTTATATTTTCCTCTAGG - Intronic
947491424 2:230598433-230598455 AGAATGATTTATTTTCCTCTGGG - Intergenic
947882815 2:233534531-233534553 TGATTTGCTAATTTTTCTCTTGG + Intronic
1169407514 20:5334896-5334918 AGAATGGTTTATATTCCTCTGGG + Intergenic
1169520034 20:6361132-6361154 AGAATGGTTTATATTCCTCTGGG + Intergenic
1169648391 20:7840084-7840106 TGAATTATTAATTATACTCCTGG + Intergenic
1169846214 20:9994818-9994840 AAAATTGTTTATTTTGCTCATGG + Intronic
1170054716 20:12188956-12188978 AGAATTGTTTATATTTCTGTGGG - Intergenic
1170485729 20:16814001-16814023 AAAAGTGTTGATTTTACACTGGG + Intergenic
1171094498 20:22318339-22318361 AGTATTGGTCATGTTACTCTCGG + Intergenic
1173297104 20:41769452-41769474 AGATTTGTTTATTCTGCTCTTGG - Intergenic
1174900903 20:54499141-54499163 TTAATTCTTAATTTAACTCTTGG + Intronic
1175165655 20:57042217-57042239 CGTATTATTAATTTTACTTTTGG - Intergenic
1175430490 20:58898825-58898847 CGAATTGTTGCTTTTGCTCTTGG + Intronic
1175461601 20:59155797-59155819 AGAATTGTTCCTTTCACTCAGGG - Intergenic
1175840836 20:62026204-62026226 AGAGTTGTTAATACGACTCTCGG - Intronic
1176637355 21:9259357-9259379 AGAATTATTCATTTAACTGTCGG + Intergenic
1177360525 21:20063415-20063437 AGAATGATTAATATTACTTTGGG - Intergenic
1177516844 21:22163681-22163703 AGAGTTATTTATTTTCCTCTGGG + Intergenic
1177852041 21:26360055-26360077 AGAATGATTTATTTGACTCTAGG - Intergenic
1177863344 21:26481713-26481735 AGAATGCTTCATTTTCCTCTGGG + Intronic
1178033391 21:28554470-28554492 AGAATGTTTATTTTTGCTCTTGG + Intergenic
1178387922 21:32170168-32170190 AGAATAGTTTATTTTTCTTTGGG - Intergenic
1179256122 21:39716832-39716854 AGAATTATTTATATTCCTCTGGG + Intergenic
1179399151 21:41068520-41068542 AGAATTCTTCCTTTTACTCTTGG + Intergenic
1180257989 21:46646784-46646806 AGATTTGCTAATTATACACTTGG + Intronic
1182045831 22:27273476-27273498 AGAAGTGTTAAATTTGTTCTTGG + Intergenic
1182932639 22:34189733-34189755 AGGATTGCTACTTTTACTTTTGG - Intergenic
949149784 3:752622-752644 AGAATTTTTCATATAACTCTTGG + Intergenic
949340329 3:3022724-3022746 AGAATTTTTTTTTTAACTCTAGG + Intronic
950982498 3:17323053-17323075 AGAAATGTTGAGTTTACTTTTGG - Intronic
951587333 3:24228866-24228888 AGAATCTATAATTTCACTCTAGG + Intronic
951610517 3:24487506-24487528 GTATTTGTTTATTTTACTCTAGG - Intronic
952317150 3:32240951-32240973 ATAATTTTTAATTTTTTTCTAGG + Intronic
952456970 3:33482317-33482339 AGAATGTTTATTTTTGCTCTTGG + Intergenic
952704149 3:36360401-36360423 AGAATGGTTTATATTCCTCTGGG - Intergenic
952756456 3:36872430-36872452 TGAATTATTAATGTTACTTTTGG - Intronic
953066942 3:39482237-39482259 AGTCTTGTTAATTCTACTCTTGG + Intronic
953999669 3:47546165-47546187 TGAAATTTTAATTTTACTCATGG + Intergenic
954857235 3:53655301-53655323 AGAATGGTTTATTTTTCTCTGGG + Intronic
955734652 3:62025275-62025297 AGATGTGTTAATGTTACTATGGG + Intronic
955770627 3:62381358-62381380 AGAACTGGGAATTTTGCTCTGGG + Intergenic
956320797 3:67993990-67994012 AGAATTTTTAATTTTTTTCTTGG + Intergenic
956996254 3:74829468-74829490 ATATTTTTTAATTTTACTTTGGG - Intergenic
957000700 3:74880555-74880577 AGAATTTTTAAATTTACTTTGGG + Intergenic
957160615 3:76604494-76604516 AGTATTGCTTTTTTTACTCTAGG - Intronic
957312045 3:78533068-78533090 AGAATGCTTAATTTTCCTATTGG - Intergenic
957507838 3:81147822-81147844 AGAATTGCTATTTTTAGTCATGG - Intergenic
957877442 3:86166304-86166326 AGATTTGTTAAATGAACTCTGGG - Intergenic
958657055 3:97016260-97016282 AGAAGTGTTGATTTTATTGTTGG - Intronic
959312376 3:104755574-104755596 TGGATTGTTAATTTAACTCAAGG - Intergenic
959893345 3:111580927-111580949 AGAAATATCAATTTTAATCTAGG + Intronic
960113419 3:113868489-113868511 AGATTTCATAAATTTACTCTAGG - Intronic
960574422 3:119215878-119215900 GATATTGTTAATTTTATTCTAGG + Intronic
962230262 3:133659414-133659436 AGAAATGTGGATTTTATTCTGGG - Intronic
962779057 3:138694001-138694023 AGAAATGTTAATTTTTGTCATGG - Intronic
963856000 3:150254461-150254483 AGAAATGTTACATTTTCTCTGGG + Intergenic
964000436 3:151764786-151764808 AGAATGGTTTATATTCCTCTGGG - Intergenic
964294653 3:155220057-155220079 AGAATTATTCATATTCCTCTGGG + Intergenic
964335248 3:155648057-155648079 AGACTTGAAAATTTAACTCTTGG + Intronic
964462739 3:156953852-156953874 AGAATTATTTATATTCCTCTGGG + Intronic
964496854 3:157300608-157300630 AAAATTATTACCTTTACTCTTGG - Intronic
964511931 3:157462221-157462243 TTAATTTTTAATTTTGCTCTGGG + Intronic
964865676 3:161257512-161257534 AGAATTGGTCATTTTTTTCTAGG + Intergenic
964961680 3:162435593-162435615 AGAAATGTAAATTTTGCCCTTGG - Intergenic
965185639 3:165459382-165459404 AGATCTGTTGATTTTAGTCTTGG + Intergenic
965249410 3:166323589-166323611 TAAAGTGTTTATTTTACTCTAGG + Intergenic
965255996 3:166411843-166411865 AGTTGTGTTCATTTTACTCTTGG + Intergenic
965941485 3:174188019-174188041 AAAAGTCTTAATTTTACTATTGG - Intronic
966577830 3:181522904-181522926 AGATTTTTTAAATTTCCTCTTGG + Intergenic
968250178 3:197202974-197202996 AGAAATGTTAATTTTAGGCCTGG + Intronic
1202749539 3_GL000221v1_random:145663-145685 AGAATTATTCATTTAACTGTCGG - Intergenic
969100918 4:4767734-4767756 AGAATGGTTACTTTTATGCTAGG + Intergenic
970088658 4:12377705-12377727 AGAATTGTTAATATTTCTGTTGG + Intergenic
971434150 4:26601914-26601936 AGAATTGTTTCTTTTTCTATAGG + Intronic
971542723 4:27841196-27841218 AGAATGGTTTATATTCCTCTGGG + Intergenic
971817850 4:31512014-31512036 AGAACTGTTAATTTTCCTTTAGG + Intergenic
971943334 4:33242886-33242908 GGAATTGTTAATATAACACTAGG + Intergenic
972323832 4:37996339-37996361 AGTATTGTTATTGTTACCCTTGG + Intronic
972582629 4:40408136-40408158 GGAATTGTTAATTTCATTTTTGG - Intergenic
973096414 4:46206746-46206768 AGAATGGTTTATTTTCCTTTGGG - Intergenic
974779288 4:66530063-66530085 AAAATTATTTATTATACTCTAGG + Intergenic
975249475 4:72161683-72161705 CCAATTGTTAATTTTTCTTTTGG + Intergenic
975535891 4:75449952-75449974 ACAAATGTAAATTGTACTCTTGG + Intergenic
975842232 4:78487197-78487219 ACAGTTGTTAATTTTCCTTTAGG + Intronic
976474554 4:85468942-85468964 AGAACAGTTAATTTTGCTATTGG + Intergenic
976532766 4:86174128-86174150 AGAATTATTTATATTACTTTGGG - Intronic
976561654 4:86508693-86508715 AGAATGTTTATTTTTGCTCTTGG - Intronic
976626713 4:87192097-87192119 AGAATGATTTATTTTCCTCTGGG + Intronic
976746234 4:88405936-88405958 AAAATTGTAAAGTGTACTCTTGG - Intronic
977013740 4:91666082-91666104 TTAATTGTTAATTTTATTTTTGG + Intergenic
977316887 4:95461432-95461454 ATAATTTATAATTTTACTTTGGG - Intronic
978200307 4:106017793-106017815 GAAATTGTTAATTGCACTCTTGG - Intergenic
978587438 4:110288991-110289013 AGAATTGTTGAAATTAGTCTGGG + Intergenic
978674129 4:111290214-111290236 AGAATTATTTATTTTTCTTTGGG - Intergenic
978865932 4:113511465-113511487 AGAAGTGTTAAATACACTCTTGG - Intronic
978939687 4:114421404-114421426 AGAAGTATCAATTTTAGTCTTGG + Intergenic
978952441 4:114577074-114577096 AGAATTATTTAGTTTCCTCTGGG + Intergenic
978986362 4:115017772-115017794 AGAAGAGTGAATTTTACTTTTGG + Intronic
979029594 4:115625330-115625352 ATTTTGGTTAATTTTACTCTTGG + Intergenic
979124546 4:116951264-116951286 AGATTTGTTTATTTTTCTTTTGG + Intergenic
979296762 4:119041800-119041822 GGAAATCTTAATTTTACACTAGG - Intronic
979629368 4:122882396-122882418 AGAATTCTGACTTTTTCTCTTGG + Intronic
980024248 4:127746291-127746313 AGAATGATTTATGTTACTCTGGG + Intronic
980086582 4:128396916-128396938 AGAATGATTAATTTTCCTTTGGG + Intergenic
980184385 4:129443715-129443737 AAAATAGCTAATATTACTCTAGG - Intergenic
980508481 4:133755088-133755110 AGAACAATTTATTTTACTCTAGG + Intergenic
980919173 4:139065212-139065234 AGAATTGTTCATTTTAACTTGGG - Intronic
981440486 4:144776645-144776667 AGAAATGTCAATGCTACTCTTGG - Intergenic
981660911 4:147165724-147165746 AGAATTTTAAAATTTATTCTCGG - Intergenic
981798651 4:148629920-148629942 AGAATTGTTATTCTTACCCCAGG - Intergenic
981822247 4:148899584-148899606 AGATTTGTCCATTTTACCCTGGG - Intergenic
981846004 4:149170233-149170255 ACAATTATCAATTTGACTCTTGG + Intergenic
983609158 4:169624034-169624056 AGATATGTTGATTTTACTTTGGG + Intronic
983864695 4:172751277-172751299 AGAATTGTGATTTTAACTGTAGG + Intronic
984300066 4:177904586-177904608 AGTGTTGTTAATTTTGCTTTCGG + Intronic
984757503 4:183337851-183337873 AGAATTGTTTCTATTAGTCTGGG - Intergenic
1202752249 4_GL000008v2_random:17777-17799 AGAATTATTCATTTAACTGTCGG + Intergenic
986003213 5:3646526-3646548 AGAATTATTTATTTTCCTCTGGG - Intergenic
987383502 5:17307804-17307826 AGAATTATTTATATTCCTCTGGG + Intergenic
987699167 5:21373918-21373940 ACAATTCTTAATTTTACTCCTGG + Intergenic
988104134 5:26721779-26721801 ATAATTGTTAATTATTGTCTTGG + Intergenic
988753253 5:34214241-34214263 ACAATTCTTAATTTTACTCCTGG - Intergenic
988918608 5:35920583-35920605 AGAATTTGGAATTTTGCTCTCGG - Intronic
988934968 5:36072524-36072546 AGAATTATTCATTTTATTTTGGG + Intergenic
989410593 5:41115936-41115958 ATAATTATTGATTTTACTTTTGG + Intergenic
989721202 5:44530751-44530773 ATAATTGTTTCTTTTCCTCTGGG + Intergenic
989961652 5:50422950-50422972 ATAATTGTGAATGTTTCTCTAGG - Intronic
990792749 5:59500262-59500284 AGAATGGTTTATTTTCCTTTGGG - Intronic
990839634 5:60062572-60062594 AGAATTATTTATATTCCTCTAGG - Intronic
991741032 5:69675092-69675114 ACAATTCTTAATTTTACTCCTGG - Intergenic
991756586 5:69879352-69879374 ACAATTCTTAATTTTACTCCTGG + Intergenic
991792606 5:70254829-70254851 ACAATTCTTAATTTTACTCCTGG - Intergenic
991820492 5:70551163-70551185 ACAATTCTTAATTTTACTCCTGG - Intergenic
991835988 5:70755265-70755287 ACAATTCTTAATTTTACTCCTGG + Intergenic
991885056 5:71255135-71255157 ACAATTCTTAATTTTACTCCTGG - Intergenic
992099337 5:73391228-73391250 AGAATTGATATTTTGATTCTTGG - Intergenic
992375948 5:76187953-76187975 ACAATTATTAATATTACTATTGG - Intronic
993092742 5:83446850-83446872 AGAATTGTTACTGTTTCTATAGG - Intergenic
993839008 5:92852897-92852919 AGAATTGTTAGATTTAAACTTGG + Intergenic
994150599 5:96443203-96443225 AGAATGGGCTATTTTACTCTTGG - Intergenic
994479284 5:100312608-100312630 AGAGTTTTTATTTTTACCCTGGG - Intergenic
994508580 5:100673703-100673725 AGAATTGGTTACTTTACTATGGG - Intergenic
994953935 5:106502295-106502317 AGACATCTTAATTTTAGTCTAGG - Intergenic
995674600 5:114649280-114649302 AAAATTGTTAACTTTACCCTTGG + Intergenic
995880019 5:116834245-116834267 AGATTTGTAATTTTTATTCTGGG + Intergenic
996106251 5:119507486-119507508 AAATTTGTAAATTTTACGCTGGG + Intronic
996308251 5:122076017-122076039 AAAATTATTAATTTAAATCTGGG - Intronic
996325076 5:122263582-122263604 ACAGTTGTTAATGTTACTATGGG - Intergenic
997057641 5:130463372-130463394 AGAATTATTTATTTTCCTTTTGG - Intergenic
997558977 5:134827899-134827921 AGAATTGTTAATTATAGGCTAGG + Intronic
999556516 5:152748738-152748760 AGAATGGTTTATATTCCTCTGGG - Intergenic
999904899 5:156129974-156129996 AGAATTATTTATATTCCTCTAGG + Intronic
999972538 5:156879231-156879253 AGACTTGCTAGTTTTCCTCTGGG - Intergenic
1000828804 5:166078363-166078385 AGGTTTATTAATTTTTCTCTTGG + Intergenic
1000951157 5:167485030-167485052 AGAATTCATAATTTTACTTTAGG + Intronic
1001378741 5:171287990-171288012 AAAAGTGTTCATTTTACTCAAGG + Intronic
1001716508 5:173820708-173820730 AGAATAGTTAATTTGGGTCTTGG - Intergenic
1002582618 5:180218138-180218160 AGAATGATTTATTTTCCTCTGGG + Intergenic
1002740849 5:181434269-181434291 GGGATTTTTAATTTCACTCTGGG + Intergenic
1002839162 6:891085-891107 AGAATTTTGAAGTTTACTGTTGG + Intergenic
1003907571 6:10716341-10716363 TGAATTGTTAATTTCACTTTTGG + Intergenic
1004029068 6:11848129-11848151 AGAATTTGTAATTTTTCCCTTGG - Intergenic
1004822303 6:19380945-19380967 ACAATTCTTACTTTTACTATAGG - Intergenic
1005444129 6:25903578-25903600 AGCATTGCTATTTTTTCTCTTGG - Intergenic
1005551419 6:26921063-26921085 ACAATTCTTAATTTTACTCCTGG - Intergenic
1005676097 6:28156907-28156929 AGAGCAGTTAACTTTACTCTTGG + Exonic
1005701957 6:28410689-28410711 AGAATGCTTTATTTTCCTCTGGG + Intergenic
1006885522 6:37378710-37378732 AGAACTGTTTCTTTTCCTCTGGG + Intronic
1006992899 6:38230580-38230602 AGTAGTGTGAATTTTATTCTAGG - Intronic
1008009470 6:46449886-46449908 AGAATTGTTGACTTTGGTCTGGG + Intronic
1008220409 6:48847266-48847288 AGAAATGTTACTTTTAGTCTGGG - Intergenic
1008759155 6:54833287-54833309 AAAATTGTTAATTTTACAAATGG - Intergenic
1008969439 6:57349506-57349528 AAAATTGTGAATTTTATTTTTGG + Intronic
1009047545 6:58248491-58248513 AGAAATGGTGATATTACTCTTGG + Intergenic
1009158411 6:60251337-60251359 AAAATTGTGAATTTTATTTTTGG + Intergenic
1009295953 6:61947581-61947603 GGAATTGAAAATTTTATTCTAGG + Intronic
1010244656 6:73651985-73652007 TGAATTGATAACTTTAATCTGGG + Intronic
1010969857 6:82251779-82251801 AGATTTGTTAGTTTTACTCCTGG + Intergenic
1011017562 6:82774020-82774042 AGAATAGTTCATTTTTCTTTGGG - Intergenic
1011077866 6:83457218-83457240 AGAAGTGTTAATATTCCTCATGG - Intergenic
1011398414 6:86935004-86935026 ACATTTGTTAATTTTTCACTTGG - Intergenic
1011909367 6:92416612-92416634 AGAATGGTTAATTTTTTTCCTGG + Intergenic
1012210718 6:96515620-96515642 ACACTTGTTAATTGGACTCTTGG - Intergenic
1012748043 6:103119577-103119599 AAAATTATTATTTTTAGTCTTGG + Intergenic
1013314822 6:108931407-108931429 AGAATGATTTATTTTCCTCTGGG + Intronic
1013618930 6:111871187-111871209 AGAAATGTTAATGTAAATCTGGG - Intronic
1013933704 6:115568198-115568220 AGAATGATTTATTTTTCTCTGGG - Intergenic
1014059562 6:117055018-117055040 TGAATTGTTACTTTTAATTTGGG + Intergenic
1015284726 6:131472620-131472642 AGAATTTTTTTTTTAACTCTGGG - Intergenic
1015631691 6:135237746-135237768 AGAATTGTTGTTTTTTCACTTGG + Intergenic
1015932558 6:138375995-138376017 AGAATTTTGGCTTTTACTCTAGG - Intergenic
1016089366 6:139957097-139957119 AGAATTGTTATCTTTACAATAGG - Intergenic
1016718728 6:147267234-147267256 TTAATTGGTAATTTTACTTTAGG + Intronic
1017120743 6:151021685-151021707 AGATTGGTTTATTTTGCTCTGGG + Intronic
1017345432 6:153373948-153373970 AGATTTGTTAATTTTTTTCCTGG - Intergenic
1017541914 6:155411967-155411989 AGAATTATTTTTTTAACTCTCGG + Intronic
1018181583 6:161227903-161227925 AGAATTTTTTATTTTCCTCTTGG - Intronic
1018624278 6:165762744-165762766 ACAATTGTTCACTTTTCTCTGGG + Intronic
1019245957 6:170709865-170709887 GGGATTTTTAATTTCACTCTGGG + Intergenic
1020714270 7:11649969-11649991 AGAAGTGTTAATTTGGCCCTGGG + Intronic
1020829111 7:13071210-13071232 ATAAATGTTAATTCTTCTCTAGG + Intergenic
1020928557 7:14364144-14364166 ATAATTGTTATTTTTTCACTTGG - Intronic
1021146431 7:17094883-17094905 AGAAATGGAAATTTTACTCTTGG - Intergenic
1022242157 7:28523023-28523045 CCAAATGTTCATTTTACTCTAGG - Intronic
1022624495 7:32020753-32020775 ACAAATCTAAATTTTACTCTGGG + Intronic
1023763109 7:43485323-43485345 AAAATTGGTCATTTTCCTCTTGG + Intronic
1025153249 7:56577771-56577793 AGAATTCCTAATTTGACTCTAGG - Intergenic
1025717986 7:63981514-63981536 AGAATTCTCAATTTTACATTAGG + Intergenic
1025744218 7:64228590-64228612 AGAATTGTGAAATTTATTCCTGG - Exonic
1025751429 7:64296995-64297017 AGAATTGTGAAATTTATTCCTGG - Intergenic
1025764132 7:64426379-64426401 AGAATACCTAATTTGACTCTAGG + Intergenic
1025767216 7:64466753-64466775 AAAATTGTTAAACTCACTCTGGG - Intergenic
1025804274 7:64814841-64814863 AGAATTTTAAATTTGACTCAAGG - Intronic
1025816478 7:64917510-64917532 AGAATATTTAATTTGACTCAAGG - Intronic
1026315954 7:69227513-69227535 AGATTTGTAAATCTTCCTCTAGG - Intergenic
1027172141 7:75879835-75879857 AGAAGTGTTTGTTTTTCTCTAGG + Intronic
1027482300 7:78713887-78713909 AGACTTGTTTATTTAACACTTGG - Intronic
1028501380 7:91521850-91521872 AGAATTGTGCATTTTAGGCTGGG - Intergenic
1028925554 7:96353869-96353891 AGAAATGTTTATTTGACACTTGG - Intergenic
1029032528 7:97483862-97483884 AGTATTTTTAATTATATTCTTGG - Intergenic
1029032539 7:97483989-97484011 TGAAATGTTAATTTTTGTCTAGG + Intergenic
1030045470 7:105491461-105491483 AGAATTCTCAAATTTACTTTGGG - Intronic
1030217525 7:107060753-107060775 ATAATTTTTAATTTTAATGTAGG + Intronic
1030222727 7:107114187-107114209 ATAATTTTTTATTCTACTCTTGG - Intronic
1030578755 7:111324587-111324609 TGAATTTTTTATTTGACTCTAGG - Intronic
1030624932 7:111833861-111833883 AGAATTGTTGCTTTTAAGCTGGG - Intronic
1030919781 7:115368186-115368208 TGAATTTCTAATTTTATTCTGGG - Intergenic
1031093478 7:117390521-117390543 AGAATGGTTTATTTTCCTTTGGG + Intronic
1031330876 7:120462512-120462534 AGAAATGGTAATATTCCTCTTGG - Intronic
1031502229 7:122532784-122532806 AAAATTGTTTATCGTACTCTCGG - Intronic
1031659006 7:124397261-124397283 AGTATTATTAATTTCACTTTAGG + Intergenic
1031987279 7:128171341-128171363 AGAGTTCTAAAGTTTACTCTTGG + Intergenic
1032648278 7:133850158-133850180 AAAATTGAAAATTTTTCTCTGGG + Intronic
1032713484 7:134483739-134483761 AGAATTGTAAACTGTACTCAGGG + Intergenic
1033028187 7:137798087-137798109 GGAATTTTTAAATTTAATCTAGG - Intronic
1033938910 7:146626494-146626516 AGAGTTACTAATTTTACTTTAGG + Intronic
1035502165 8:98333-98355 GGGATTTTTAATTTAACTCTGGG - Intergenic
1035763756 8:2088747-2088769 AGAATGGTTTATTTTCCTTTGGG + Intronic
1036528679 8:9559803-9559825 AGGATTCTTAATTTTACTGCTGG - Intronic
1036954659 8:13174349-13174371 AGAATGATTTATTTTCCTCTGGG + Intronic
1037188638 8:16095327-16095349 AGAATTCTGAAATCTACTCTGGG - Intergenic
1037398040 8:18463836-18463858 AGAATAGTTACTATTCCTCTGGG + Intergenic
1038826761 8:31011387-31011409 AGAATAGTTATTTTCACCCTAGG + Intronic
1038982474 8:32775061-32775083 TGAAGGGTTAATTTTAATCTTGG - Intergenic
1039237823 8:35522161-35522183 ATATTTTTTTATTTTACTCTGGG + Intronic
1039715117 8:40099841-40099863 AGAGTTTGTAATTTTAGTCTTGG - Intergenic
1040362361 8:46678876-46678898 TGAATTCTTGATTTTATTCTTGG + Intergenic
1040486879 8:47881610-47881632 TGAATTGTTAATTTAATTTTGGG + Intronic
1040923924 8:52655376-52655398 AGTATTTTTACTTTTAATCTGGG - Intronic
1041116778 8:54547619-54547641 AGAATTATTTATATTACTTTAGG - Intergenic
1041385279 8:57295340-57295362 AGAATTGTTAAACTTATTCAGGG + Intergenic
1041627208 8:60044223-60044245 AGAAATGTTAATTCTACTTGGGG - Intergenic
1041849232 8:62369482-62369504 AGAATGTTTATTTTTGCTCTTGG - Intronic
1042375032 8:68040329-68040351 AGGAGTGTGAATTTTATTCTAGG - Intronic
1043721652 8:83552249-83552271 AGAATTATTTATTTTCCTTTTGG - Intergenic
1043755009 8:83992484-83992506 AGAATAATTTATATTACTCTGGG - Intergenic
1043821308 8:84868550-84868572 AGAATTGTTAAACTTACTTTTGG - Intronic
1044153639 8:88815615-88815637 AAAATTGTTTATTTTCCTTTGGG - Intergenic
1045643188 8:104274202-104274224 AAAATTGTTAGTCTTATTCTAGG + Intergenic
1045943752 8:107770690-107770712 AGAAGTGTTATTTTTATTCCAGG - Intergenic
1046482030 8:114834519-114834541 AAAATTTTTAATGTTATTCTTGG + Intergenic
1046525688 8:115379513-115379535 ACAATGGTTAATTGTAGTCTGGG - Intergenic
1046562455 8:115855174-115855196 AGAATTATGGATTTTCCTCTGGG - Intergenic
1047694123 8:127385811-127385833 AGAGCTGCTAATTTTCCTCTGGG + Intergenic
1047783773 8:128133869-128133891 AGAAGTGTTAATTTTACTTAAGG + Intergenic
1047939043 8:129809902-129809924 AGAATAGTTTATTTTCCTTTGGG + Intergenic
1048167254 8:132074061-132074083 AGTACTGTTAATCTCACTCTTGG + Intronic
1048605305 8:135962298-135962320 AGAATTGTGCCTTTTCCTCTGGG - Intergenic
1048790230 8:138096362-138096384 AGAATTTTTATTTCTACTTTAGG + Intergenic
1049130154 8:140832359-140832381 AGAGTTCTTAATTTGAATCTTGG + Intronic
1049934646 9:489837-489859 AGAACTGTTAACTATAATCTTGG - Intronic
1050731742 9:8716895-8716917 AGAATTGAAAATTTTAGGCTGGG + Intronic
1050964047 9:11774580-11774602 AGAATTATTAATCATACTATTGG - Intergenic
1052635335 9:31095849-31095871 AGAATGATTTATTTTCCTCTGGG - Intergenic
1052950665 9:34208125-34208147 AGAATTGTTAATGTTGGTGTTGG + Intronic
1055143453 9:72903448-72903470 AAAATTTATAATTTAACTCTTGG + Intronic
1055148730 9:72968251-72968273 AGAATTATTTATTTTTCTGTGGG + Intronic
1055204984 9:73718436-73718458 ATAATTGATATTTTAACTCTGGG + Intergenic
1055315936 9:75034382-75034404 GGATTTATTATTTTTACTCTTGG + Intergenic
1055969367 9:81896534-81896556 AGAATGATTTATTTTCCTCTGGG - Intergenic
1055994126 9:82139270-82139292 AGAGTTGTTAATTGTCCTATAGG - Intergenic
1056652541 9:88479758-88479780 AGAATTTTTGTTTTTTCTCTTGG + Intergenic
1057318063 9:93984234-93984256 AGAATGGTTTATTTTACTTTGGG - Intergenic
1057358832 9:94354854-94354876 AGAAAAGTCAATTTTACTGTAGG + Intergenic
1057648921 9:96902738-96902760 AGAAAAGTCAATTTTACTGTAGG - Intronic
1058359607 9:104128602-104128624 AGAAATGATAATTGTACTTTGGG + Intronic
1059091984 9:111369275-111369297 AGAATTTATCATTTAACTCTTGG - Intronic
1059713102 9:116887570-116887592 AGAATTTTGAGTTTTACTATAGG + Intronic
1060065778 9:120499553-120499575 AAAATTGTTAATTTTTTTCTTGG + Intronic
1060082360 9:120661607-120661629 AGAAATGTGAATTTTCCTTTGGG - Intronic
1062085554 9:134646236-134646258 ACCATTGTGAATTTTACTCAGGG + Intronic
1203443034 Un_GL000219v1:29031-29053 GGGATTGTTAATCTTACTCCTGG - Intergenic
1203513842 Un_KI270741v1:147940-147962 GGGATTGTTAATCTTACTCCTGG - Intergenic
1203718181 Un_KI270742v1:175754-175776 AGAATTATTCATTTAACTGTCGG - Intergenic
1203533038 Un_KI270743v1:2473-2495 AGAATTATTCATTTAACTGTCGG + Intergenic
1203606157 Un_KI270748v1:59076-59098 GGGATTTTTAATTTCACTCTGGG + Intergenic
1185920352 X:4084458-4084480 AGAAGTTTAAATTTTTCTCTTGG - Intergenic
1185984789 X:4819976-4819998 AGAATCGTTATTCATACTCTGGG + Intergenic
1186645747 X:11505556-11505578 AGAATTATTTATATTCCTCTGGG - Intronic
1187081495 X:15994151-15994173 AGGATTTTAACTTTTACTCTGGG - Intergenic
1187179178 X:16927287-16927309 AAAATGGTTAATTTTACATTAGG - Intergenic
1187540747 X:20191694-20191716 AGAATTTTGAATATTTCTCTCGG - Intronic
1187835943 X:23432626-23432648 AGAATGATTTATTTTTCTCTGGG - Intergenic
1188322855 X:28761268-28761290 AGAATGATTTATTTTCCTCTCGG - Intronic
1188371226 X:29371925-29371947 AGAATGATTTATTTTCCTCTGGG + Intronic
1188556826 X:31421398-31421420 AAACTTGTTTATTTTATTCTAGG + Intronic
1188856592 X:35203793-35203815 AGAATAATTAATTTTCCTTTGGG - Intergenic
1189761599 X:44327203-44327225 TGAATTGTTACTTTTGCTTTTGG + Intronic
1189936314 X:46072714-46072736 AGAATGATTTATTTTCCTCTAGG + Intergenic
1190125746 X:47703900-47703922 AGAATAATTGATTTTACCCTGGG - Intergenic
1190897648 X:54636856-54636878 AGAATGGTTTATTTTCCTTTGGG + Intergenic
1190975384 X:55395181-55395203 AGAATTTTTAATTATATTCTGGG + Intergenic
1191671007 X:63748880-63748902 AGAACTGTTCATGCTACTCTAGG - Intronic
1191688667 X:63918243-63918265 AGAACTGTTTATGATACTCTGGG - Intergenic
1191989179 X:67014535-67014557 AGAATTATTTATATTCCTCTGGG - Intergenic
1192347571 X:70323645-70323667 TAAAATGTTAATTTTACTATAGG - Intronic
1192837797 X:74820511-74820533 AGAATAGTTAATATTCCTTTGGG - Intronic
1193103268 X:77639838-77639860 AGAATTATTTATTTTCCTTTGGG - Intronic
1193116878 X:77784369-77784391 AGAATAATTAATTTTACACAAGG - Intronic
1193160549 X:78224259-78224281 AGAATTATTTATATTCCTCTGGG - Intergenic
1193308450 X:79976633-79976655 AGAATAATTTATTTTCCTCTAGG - Intergenic
1193451695 X:81678657-81678679 AGAATTGTTTCTTTGACTTTTGG + Intergenic
1193482043 X:82038691-82038713 AGAATTATTTATTTTCCTTTGGG - Intergenic
1194070016 X:89310934-89310956 AGAATTGTTTTTTCTATTCTGGG + Intergenic
1194209417 X:91052507-91052529 TGCATTGTCATTTTTACTCTTGG - Intergenic
1194276320 X:91887903-91887925 AGACTTGATATTTTTACTCAGGG - Intronic
1194442578 X:93950975-93950997 AGAATAATTTATTTTACTCTGGG + Intergenic
1194791587 X:98157821-98157843 AGAATTATTTATATTCCTCTGGG - Intergenic
1194901608 X:99519315-99519337 AGAATTATTTATTTTTCTTTGGG - Intergenic
1195436563 X:104851150-104851172 AGAATGGTTATTTTTGCTCTTGG + Intronic
1195588533 X:106596911-106596933 AGAATTATTTATTTTTCTTTGGG - Intergenic
1195623019 X:106977116-106977138 AAAATTGTTTATTTTAATATAGG - Intronic
1196024355 X:111024587-111024609 AGAATTGTGATTTTTTCTGTTGG - Intronic
1196654615 X:118203960-118203982 AGACTTCTTGTTTTTACTCTTGG + Intergenic
1197040170 X:121927689-121927711 AGAATTATTTATATTACTTTGGG - Intergenic
1197356382 X:125440896-125440918 AGAATAATTAATATTCCTCTGGG + Intergenic
1198165534 X:134051889-134051911 ATTATTATTAATTTTACTTTAGG + Intergenic
1198321796 X:135525121-135525143 ATAATTGTTGTTTTTAGTCTTGG + Intronic
1199312559 X:146338371-146338393 AGAATTGTTATTTTTTTTCCCGG + Intergenic
1199804564 X:151285168-151285190 AGAATGATTTATTTTATTCTGGG + Intergenic
1199912555 X:152303063-152303085 AGAATTATTTATTTTCCTTTGGG + Intronic
1200593623 Y:5109684-5109706 AGACTTGATATTTTTACTCAGGG - Intronic
1200724254 Y:6646568-6646590 AGAATTGTTTTTTCTATTCTGGG + Intergenic
1202388316 Y:24345512-24345534 GGGATTTTTAATTTCACTCTGGG + Intergenic
1202482471 Y:25324616-25324638 GGGATTTTTAATTTCACTCTGGG - Intergenic