ID: 1164288324

View in Genome Browser
Species Human (GRCh38)
Location 19:23842506-23842528
Sequence CATATTTAGCAAGTGGTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164288324_1164288327 -2 Left 1164288324 19:23842506-23842528 CCCATGACCACTTGCTAAATATG No data
Right 1164288327 19:23842527-23842549 TGTGTGTTTTTTTTTTTTTTAGG No data
1164288324_1164288328 16 Left 1164288324 19:23842506-23842528 CCCATGACCACTTGCTAAATATG No data
Right 1164288328 19:23842545-23842567 TTAGGAAATGTTAACTTTCAAGG No data
1164288324_1164288329 22 Left 1164288324 19:23842506-23842528 CCCATGACCACTTGCTAAATATG No data
Right 1164288329 19:23842551-23842573 AATGTTAACTTTCAAGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164288324 Original CRISPR CATATTTAGCAAGTGGTCAT GGG (reversed) Intergenic
No off target data available for this crispr