ID: 1164288325

View in Genome Browser
Species Human (GRCh38)
Location 19:23842507-23842529
Sequence ACATATTTAGCAAGTGGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164288325_1164288329 21 Left 1164288325 19:23842507-23842529 CCATGACCACTTGCTAAATATGT No data
Right 1164288329 19:23842551-23842573 AATGTTAACTTTCAAGGCTGTGG No data
1164288325_1164288327 -3 Left 1164288325 19:23842507-23842529 CCATGACCACTTGCTAAATATGT No data
Right 1164288327 19:23842527-23842549 TGTGTGTTTTTTTTTTTTTTAGG No data
1164288325_1164288328 15 Left 1164288325 19:23842507-23842529 CCATGACCACTTGCTAAATATGT No data
Right 1164288328 19:23842545-23842567 TTAGGAAATGTTAACTTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164288325 Original CRISPR ACATATTTAGCAAGTGGTCA TGG (reversed) Intergenic
No off target data available for this crispr