ID: 1164288327

View in Genome Browser
Species Human (GRCh38)
Location 19:23842527-23842549
Sequence TGTGTGTTTTTTTTTTTTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164288325_1164288327 -3 Left 1164288325 19:23842507-23842529 CCATGACCACTTGCTAAATATGT No data
Right 1164288327 19:23842527-23842549 TGTGTGTTTTTTTTTTTTTTAGG No data
1164288323_1164288327 22 Left 1164288323 19:23842482-23842504 CCTAGAGTAAAATTAACAATTCT 0: 2
1: 1
2: 0
3: 58
4: 562
Right 1164288327 19:23842527-23842549 TGTGTGTTTTTTTTTTTTTTAGG No data
1164288326_1164288327 -9 Left 1164288326 19:23842513-23842535 CCACTTGCTAAATATGTGTGTTT No data
Right 1164288327 19:23842527-23842549 TGTGTGTTTTTTTTTTTTTTAGG No data
1164288324_1164288327 -2 Left 1164288324 19:23842506-23842528 CCCATGACCACTTGCTAAATATG No data
Right 1164288327 19:23842527-23842549 TGTGTGTTTTTTTTTTTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164288327 Original CRISPR TGTGTGTTTTTTTTTTTTTT AGG Intergenic
No off target data available for this crispr