ID: 1164288328

View in Genome Browser
Species Human (GRCh38)
Location 19:23842545-23842567
Sequence TTAGGAAATGTTAACTTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164288324_1164288328 16 Left 1164288324 19:23842506-23842528 CCCATGACCACTTGCTAAATATG No data
Right 1164288328 19:23842545-23842567 TTAGGAAATGTTAACTTTCAAGG No data
1164288326_1164288328 9 Left 1164288326 19:23842513-23842535 CCACTTGCTAAATATGTGTGTTT No data
Right 1164288328 19:23842545-23842567 TTAGGAAATGTTAACTTTCAAGG No data
1164288325_1164288328 15 Left 1164288325 19:23842507-23842529 CCATGACCACTTGCTAAATATGT No data
Right 1164288328 19:23842545-23842567 TTAGGAAATGTTAACTTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164288328 Original CRISPR TTAGGAAATGTTAACTTTCA AGG Intergenic
No off target data available for this crispr