ID: 1164291827

View in Genome Browser
Species Human (GRCh38)
Location 19:23876587-23876609
Sequence CCCACAGGTGGTGTTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164291827_1164291833 -8 Left 1164291827 19:23876587-23876609 CCAGCCTCAACACCACCTGTGGG No data
Right 1164291833 19:23876602-23876624 CCTGTGGGGTACCTGAAGTCCGG No data
1164291827_1164291834 -5 Left 1164291827 19:23876587-23876609 CCAGCCTCAACACCACCTGTGGG No data
Right 1164291834 19:23876605-23876627 GTGGGGTACCTGAAGTCCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164291827 Original CRISPR CCCACAGGTGGTGTTGAGGC TGG (reversed) Intergenic
No off target data available for this crispr