ID: 1164291833

View in Genome Browser
Species Human (GRCh38)
Location 19:23876602-23876624
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164291827_1164291833 -8 Left 1164291827 19:23876587-23876609 CCAGCCTCAACACCACCTGTGGG No data
Right 1164291833 19:23876602-23876624 CCTGTGGGGTACCTGAAGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164291833 Original CRISPR CCTGTGGGGTACCTGAAGTC CGG Intergenic