ID: 1164291834 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:23876605-23876627 |
| Sequence | GTGGGGTACCTGAAGTCCGG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1164291827_1164291834 | -5 | Left | 1164291827 | 19:23876587-23876609 | CCAGCCTCAACACCACCTGTGGG | No data | ||
| Right | 1164291834 | 19:23876605-23876627 | GTGGGGTACCTGAAGTCCGGTGG | No data | ||||
| 1164291830_1164291834 | -9 | Left | 1164291830 | 19:23876591-23876613 | CCTCAACACCACCTGTGGGGTAC | No data | ||
| Right | 1164291834 | 19:23876605-23876627 | GTGGGGTACCTGAAGTCCGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1164291834 | Original CRISPR | GTGGGGTACCTGAAGTCCGG TGG | Intergenic | ||