ID: 1164291991

View in Genome Browser
Species Human (GRCh38)
Location 19:23877513-23877535
Sequence GGCAGAGGACACTGGCACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164291991_1164292001 21 Left 1164291991 19:23877513-23877535 CCTCAGTGCCAGTGTCCTCTGCC No data
Right 1164292001 19:23877557-23877579 GCAGGGTGCGGAAAGCACCCTGG No data
1164291991_1164291999 4 Left 1164291991 19:23877513-23877535 CCTCAGTGCCAGTGTCCTCTGCC No data
Right 1164291999 19:23877540-23877562 AAGGTCAAATCGGCAGAGCAGGG No data
1164291991_1164292000 9 Left 1164291991 19:23877513-23877535 CCTCAGTGCCAGTGTCCTCTGCC No data
Right 1164292000 19:23877545-23877567 CAAATCGGCAGAGCAGGGTGCGG No data
1164291991_1164291998 3 Left 1164291991 19:23877513-23877535 CCTCAGTGCCAGTGTCCTCTGCC No data
Right 1164291998 19:23877539-23877561 AAAGGTCAAATCGGCAGAGCAGG No data
1164291991_1164291995 -6 Left 1164291991 19:23877513-23877535 CCTCAGTGCCAGTGTCCTCTGCC No data
Right 1164291995 19:23877530-23877552 TCTGCCCAGAAAGGTCAAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164291991 Original CRISPR GGCAGAGGACACTGGCACTG AGG (reversed) Intergenic
No off target data available for this crispr