ID: 1164293107

View in Genome Browser
Species Human (GRCh38)
Location 19:23885168-23885190
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164293101_1164293107 0 Left 1164293101 19:23885145-23885167 CCTGGTATGTGAGCAAAGAACCC No data
Right 1164293107 19:23885168-23885190 ATTCTAGGAGGTGCAGCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164293107 Original CRISPR ATTCTAGGAGGTGCAGCCTT GGG Intergenic