ID: 1164293638

View in Genome Browser
Species Human (GRCh38)
Location 19:23889643-23889665
Sequence TCCAAGGCCCTCTGTGGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164293638_1164293643 2 Left 1164293638 19:23889643-23889665 CCCCTTCCACAGAGGGCCTTGGA No data
Right 1164293643 19:23889668-23889690 ATATTTTTTTTATCCATCGCTGG No data
1164293638_1164293644 3 Left 1164293638 19:23889643-23889665 CCCCTTCCACAGAGGGCCTTGGA No data
Right 1164293644 19:23889669-23889691 TATTTTTTTTATCCATCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164293638 Original CRISPR TCCAAGGCCCTCTGTGGAAG GGG (reversed) Intergenic
No off target data available for this crispr