ID: 1164304863

View in Genome Browser
Species Human (GRCh38)
Location 19:23997229-23997251
Sequence ACCTGGGTGATCTTTCCAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164304863_1164304871 29 Left 1164304863 19:23997229-23997251 CCAATTGGAAAGATCACCCAGGT No data
Right 1164304871 19:23997281-23997303 TCACAATCACATCTTTCTGCTGG No data
1164304863_1164304868 -4 Left 1164304863 19:23997229-23997251 CCAATTGGAAAGATCACCCAGGT No data
Right 1164304868 19:23997248-23997270 AGGTGCGACCAGGGAGATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164304863 Original CRISPR ACCTGGGTGATCTTTCCAAT TGG (reversed) Intergenic
No off target data available for this crispr