ID: 1164304867

View in Genome Browser
Species Human (GRCh38)
Location 19:23997246-23997268
Sequence TCAATCTCCCTGGTCGCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164304867_1164304871 12 Left 1164304867 19:23997246-23997268 CCAGGTGCGACCAGGGAGATTGA No data
Right 1164304871 19:23997281-23997303 TCACAATCACATCTTTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164304867 Original CRISPR TCAATCTCCCTGGTCGCACC TGG (reversed) Intergenic
No off target data available for this crispr