ID: 1164304869

View in Genome Browser
Species Human (GRCh38)
Location 19:23997256-23997278
Sequence CACTGCGGCCTCAATCTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164304869_1164304871 2 Left 1164304869 19:23997256-23997278 CCAGGGAGATTGAGGCCGCAGTG No data
Right 1164304871 19:23997281-23997303 TCACAATCACATCTTTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164304869 Original CRISPR CACTGCGGCCTCAATCTCCC TGG (reversed) Intergenic
No off target data available for this crispr