ID: 1164304871

View in Genome Browser
Species Human (GRCh38)
Location 19:23997281-23997303
Sequence TCACAATCACATCTTTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164304863_1164304871 29 Left 1164304863 19:23997229-23997251 CCAATTGGAAAGATCACCCAGGT No data
Right 1164304871 19:23997281-23997303 TCACAATCACATCTTTCTGCTGG No data
1164304867_1164304871 12 Left 1164304867 19:23997246-23997268 CCAGGTGCGACCAGGGAGATTGA No data
Right 1164304871 19:23997281-23997303 TCACAATCACATCTTTCTGCTGG No data
1164304869_1164304871 2 Left 1164304869 19:23997256-23997278 CCAGGGAGATTGAGGCCGCAGTG No data
Right 1164304871 19:23997281-23997303 TCACAATCACATCTTTCTGCTGG No data
1164304861_1164304871 30 Left 1164304861 19:23997228-23997250 CCCAATTGGAAAGATCACCCAGG No data
Right 1164304871 19:23997281-23997303 TCACAATCACATCTTTCTGCTGG No data
1164304866_1164304871 13 Left 1164304866 19:23997245-23997267 CCCAGGTGCGACCAGGGAGATTG No data
Right 1164304871 19:23997281-23997303 TCACAATCACATCTTTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164304871 Original CRISPR TCACAATCACATCTTTCTGC TGG Intergenic
No off target data available for this crispr