ID: 1164305974

View in Genome Browser
Species Human (GRCh38)
Location 19:24004023-24004045
Sequence CAAGCGGTCCAGGGTTCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164305974_1164305983 8 Left 1164305974 19:24004023-24004045 CCAGGCGAACCCTGGACCGCTTG No data
Right 1164305983 19:24004054-24004076 GGGAGCTCTCTAGGGGAACCCGG No data
1164305974_1164305982 1 Left 1164305974 19:24004023-24004045 CCAGGCGAACCCTGGACCGCTTG No data
Right 1164305982 19:24004047-24004069 AGCACGAGGGAGCTCTCTAGGGG No data
1164305974_1164305980 -1 Left 1164305974 19:24004023-24004045 CCAGGCGAACCCTGGACCGCTTG No data
Right 1164305980 19:24004045-24004067 GCAGCACGAGGGAGCTCTCTAGG No data
1164305974_1164305985 25 Left 1164305974 19:24004023-24004045 CCAGGCGAACCCTGGACCGCTTG No data
Right 1164305985 19:24004071-24004093 ACCCGGACTGTGGCAGCCACAGG No data
1164305974_1164305981 0 Left 1164305974 19:24004023-24004045 CCAGGCGAACCCTGGACCGCTTG No data
Right 1164305981 19:24004046-24004068 CAGCACGAGGGAGCTCTCTAGGG No data
1164305974_1164305984 15 Left 1164305974 19:24004023-24004045 CCAGGCGAACCCTGGACCGCTTG No data
Right 1164305984 19:24004061-24004083 CTCTAGGGGAACCCGGACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164305974 Original CRISPR CAAGCGGTCCAGGGTTCGCC TGG (reversed) Intergenic