ID: 1164305990

View in Genome Browser
Species Human (GRCh38)
Location 19:24004088-24004110
Sequence CACAGGAACTCGGCCCCAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164305987_1164305990 -8 Left 1164305987 19:24004073-24004095 CCGGACTGTGGCAGCCACAGGAA No data
Right 1164305990 19:24004088-24004110 CACAGGAACTCGGCCCCAGCCGG No data
1164305979_1164305990 26 Left 1164305979 19:24004039-24004061 CCGCTTGCAGCACGAGGGAGCTC No data
Right 1164305990 19:24004088-24004110 CACAGGAACTCGGCCCCAGCCGG No data
1164305986_1164305990 -7 Left 1164305986 19:24004072-24004094 CCCGGACTGTGGCAGCCACAGGA No data
Right 1164305990 19:24004088-24004110 CACAGGAACTCGGCCCCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164305990 Original CRISPR CACAGGAACTCGGCCCCAGC CGG Intergenic
No off target data available for this crispr