ID: 1164306042

View in Genome Browser
Species Human (GRCh38)
Location 19:24004277-24004299
Sequence GGTTCCCTTGCAGGGCTCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164306042_1164306054 17 Left 1164306042 19:24004277-24004299 CCAACGAGCCCTGCAAGGGAACC No data
Right 1164306054 19:24004317-24004339 GGGAGGCCAGAAGCACCCCTTGG No data
1164306042_1164306045 -4 Left 1164306042 19:24004277-24004299 CCAACGAGCCCTGCAAGGGAACC No data
Right 1164306045 19:24004296-24004318 AACCGCCAGCCATGCACCCCTGG No data
1164306042_1164306046 -3 Left 1164306042 19:24004277-24004299 CCAACGAGCCCTGCAAGGGAACC No data
Right 1164306046 19:24004297-24004319 ACCGCCAGCCATGCACCCCTGGG No data
1164306042_1164306048 0 Left 1164306042 19:24004277-24004299 CCAACGAGCCCTGCAAGGGAACC No data
Right 1164306048 19:24004300-24004322 GCCAGCCATGCACCCCTGGGAGG No data
1164306042_1164306055 18 Left 1164306042 19:24004277-24004299 CCAACGAGCCCTGCAAGGGAACC No data
Right 1164306055 19:24004318-24004340 GGAGGCCAGAAGCACCCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164306042 Original CRISPR GGTTCCCTTGCAGGGCTCGT TGG (reversed) Intergenic