ID: 1164306043

View in Genome Browser
Species Human (GRCh38)
Location 19:24004285-24004307
Sequence TGGCTGGCGGTTCCCTTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164306043_1164306048 -8 Left 1164306043 19:24004285-24004307 CCCTGCAAGGGAACCGCCAGCCA No data
Right 1164306048 19:24004300-24004322 GCCAGCCATGCACCCCTGGGAGG No data
1164306043_1164306055 10 Left 1164306043 19:24004285-24004307 CCCTGCAAGGGAACCGCCAGCCA No data
Right 1164306055 19:24004318-24004340 GGAGGCCAGAAGCACCCCTTGGG No data
1164306043_1164306054 9 Left 1164306043 19:24004285-24004307 CCCTGCAAGGGAACCGCCAGCCA No data
Right 1164306054 19:24004317-24004339 GGGAGGCCAGAAGCACCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164306043 Original CRISPR TGGCTGGCGGTTCCCTTGCA GGG (reversed) Intergenic