ID: 1164306044

View in Genome Browser
Species Human (GRCh38)
Location 19:24004286-24004308
Sequence ATGGCTGGCGGTTCCCTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164306044_1164306048 -9 Left 1164306044 19:24004286-24004308 CCTGCAAGGGAACCGCCAGCCAT No data
Right 1164306048 19:24004300-24004322 GCCAGCCATGCACCCCTGGGAGG No data
1164306044_1164306054 8 Left 1164306044 19:24004286-24004308 CCTGCAAGGGAACCGCCAGCCAT No data
Right 1164306054 19:24004317-24004339 GGGAGGCCAGAAGCACCCCTTGG No data
1164306044_1164306055 9 Left 1164306044 19:24004286-24004308 CCTGCAAGGGAACCGCCAGCCAT No data
Right 1164306055 19:24004318-24004340 GGAGGCCAGAAGCACCCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164306044 Original CRISPR ATGGCTGGCGGTTCCCTTGC AGG (reversed) Intergenic