ID: 1164306047

View in Genome Browser
Species Human (GRCh38)
Location 19:24004298-24004320
Sequence TCCCAGGGGTGCATGGCTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164306047_1164306060 29 Left 1164306047 19:24004298-24004320 CCGCCAGCCATGCACCCCTGGGA No data
Right 1164306060 19:24004350-24004372 CAGCAAGTGATGACTCAGACAGG No data
1164306047_1164306055 -3 Left 1164306047 19:24004298-24004320 CCGCCAGCCATGCACCCCTGGGA No data
Right 1164306055 19:24004318-24004340 GGAGGCCAGAAGCACCCCTTGGG No data
1164306047_1164306054 -4 Left 1164306047 19:24004298-24004320 CCGCCAGCCATGCACCCCTGGGA No data
Right 1164306054 19:24004317-24004339 GGGAGGCCAGAAGCACCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164306047 Original CRISPR TCCCAGGGGTGCATGGCTGG CGG (reversed) Intergenic