ID: 1164306048

View in Genome Browser
Species Human (GRCh38)
Location 19:24004300-24004322
Sequence GCCAGCCATGCACCCCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164306037_1164306048 24 Left 1164306037 19:24004253-24004275 CCTGTACTTGGGAGGACAGAGGG No data
Right 1164306048 19:24004300-24004322 GCCAGCCATGCACCCCTGGGAGG No data
1164306044_1164306048 -9 Left 1164306044 19:24004286-24004308 CCTGCAAGGGAACCGCCAGCCAT No data
Right 1164306048 19:24004300-24004322 GCCAGCCATGCACCCCTGGGAGG No data
1164306042_1164306048 0 Left 1164306042 19:24004277-24004299 CCAACGAGCCCTGCAAGGGAACC No data
Right 1164306048 19:24004300-24004322 GCCAGCCATGCACCCCTGGGAGG No data
1164306043_1164306048 -8 Left 1164306043 19:24004285-24004307 CCCTGCAAGGGAACCGCCAGCCA No data
Right 1164306048 19:24004300-24004322 GCCAGCCATGCACCCCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164306048 Original CRISPR GCCAGCCATGCACCCCTGGG AGG Intergenic