ID: 1164306049

View in Genome Browser
Species Human (GRCh38)
Location 19:24004301-24004323
Sequence GCCTCCCAGGGGTGCATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164306049_1164306055 -6 Left 1164306049 19:24004301-24004323 CCAGCCATGCACCCCTGGGAGGC No data
Right 1164306055 19:24004318-24004340 GGAGGCCAGAAGCACCCCTTGGG No data
1164306049_1164306060 26 Left 1164306049 19:24004301-24004323 CCAGCCATGCACCCCTGGGAGGC No data
Right 1164306060 19:24004350-24004372 CAGCAAGTGATGACTCAGACAGG No data
1164306049_1164306054 -7 Left 1164306049 19:24004301-24004323 CCAGCCATGCACCCCTGGGAGGC No data
Right 1164306054 19:24004317-24004339 GGGAGGCCAGAAGCACCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164306049 Original CRISPR GCCTCCCAGGGGTGCATGGC TGG (reversed) Intergenic