ID: 1164306050

View in Genome Browser
Species Human (GRCh38)
Location 19:24004305-24004327
Sequence TCTGGCCTCCCAGGGGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164306050_1164306060 22 Left 1164306050 19:24004305-24004327 CCATGCACCCCTGGGAGGCCAGA No data
Right 1164306060 19:24004350-24004372 CAGCAAGTGATGACTCAGACAGG No data
1164306050_1164306055 -10 Left 1164306050 19:24004305-24004327 CCATGCACCCCTGGGAGGCCAGA No data
Right 1164306055 19:24004318-24004340 GGAGGCCAGAAGCACCCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164306050 Original CRISPR TCTGGCCTCCCAGGGGTGCA TGG (reversed) Intergenic