ID: 1164306054

View in Genome Browser
Species Human (GRCh38)
Location 19:24004317-24004339
Sequence GGGAGGCCAGAAGCACCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164306042_1164306054 17 Left 1164306042 19:24004277-24004299 CCAACGAGCCCTGCAAGGGAACC No data
Right 1164306054 19:24004317-24004339 GGGAGGCCAGAAGCACCCCTTGG No data
1164306047_1164306054 -4 Left 1164306047 19:24004298-24004320 CCGCCAGCCATGCACCCCTGGGA No data
Right 1164306054 19:24004317-24004339 GGGAGGCCAGAAGCACCCCTTGG No data
1164306043_1164306054 9 Left 1164306043 19:24004285-24004307 CCCTGCAAGGGAACCGCCAGCCA No data
Right 1164306054 19:24004317-24004339 GGGAGGCCAGAAGCACCCCTTGG No data
1164306049_1164306054 -7 Left 1164306049 19:24004301-24004323 CCAGCCATGCACCCCTGGGAGGC No data
Right 1164306054 19:24004317-24004339 GGGAGGCCAGAAGCACCCCTTGG No data
1164306044_1164306054 8 Left 1164306044 19:24004286-24004308 CCTGCAAGGGAACCGCCAGCCAT No data
Right 1164306054 19:24004317-24004339 GGGAGGCCAGAAGCACCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164306054 Original CRISPR GGGAGGCCAGAAGCACCCCT TGG Intergenic