ID: 1164306055

View in Genome Browser
Species Human (GRCh38)
Location 19:24004318-24004340
Sequence GGAGGCCAGAAGCACCCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164306042_1164306055 18 Left 1164306042 19:24004277-24004299 CCAACGAGCCCTGCAAGGGAACC No data
Right 1164306055 19:24004318-24004340 GGAGGCCAGAAGCACCCCTTGGG No data
1164306044_1164306055 9 Left 1164306044 19:24004286-24004308 CCTGCAAGGGAACCGCCAGCCAT No data
Right 1164306055 19:24004318-24004340 GGAGGCCAGAAGCACCCCTTGGG No data
1164306050_1164306055 -10 Left 1164306050 19:24004305-24004327 CCATGCACCCCTGGGAGGCCAGA No data
Right 1164306055 19:24004318-24004340 GGAGGCCAGAAGCACCCCTTGGG No data
1164306047_1164306055 -3 Left 1164306047 19:24004298-24004320 CCGCCAGCCATGCACCCCTGGGA No data
Right 1164306055 19:24004318-24004340 GGAGGCCAGAAGCACCCCTTGGG No data
1164306043_1164306055 10 Left 1164306043 19:24004285-24004307 CCCTGCAAGGGAACCGCCAGCCA No data
Right 1164306055 19:24004318-24004340 GGAGGCCAGAAGCACCCCTTGGG No data
1164306049_1164306055 -6 Left 1164306049 19:24004301-24004323 CCAGCCATGCACCCCTGGGAGGC No data
Right 1164306055 19:24004318-24004340 GGAGGCCAGAAGCACCCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164306055 Original CRISPR GGAGGCCAGAAGCACCCCTT GGG Intergenic