ID: 1164309985

View in Genome Browser
Species Human (GRCh38)
Location 19:24037111-24037133
Sequence CTACAGATACTGATTCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164309985_1164309990 23 Left 1164309985 19:24037111-24037133 CCTGCCTGAATCAGTATCTGTAG No data
Right 1164309990 19:24037157-24037179 CATGCACTGTCCCCCACTCACGG 0: 1
1: 0
2: 2
3: 16
4: 188
1164309985_1164309991 24 Left 1164309985 19:24037111-24037133 CCTGCCTGAATCAGTATCTGTAG No data
Right 1164309991 19:24037158-24037180 ATGCACTGTCCCCCACTCACGGG 0: 1
1: 0
2: 2
3: 7
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164309985 Original CRISPR CTACAGATACTGATTCAGGC AGG (reversed) Intronic
No off target data available for this crispr