ID: 1164309991

View in Genome Browser
Species Human (GRCh38)
Location 19:24037158-24037180
Sequence ATGCACTGTCCCCCACTCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 155}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164309985_1164309991 24 Left 1164309985 19:24037111-24037133 CCTGCCTGAATCAGTATCTGTAG No data
Right 1164309991 19:24037158-24037180 ATGCACTGTCCCCCACTCACGGG 0: 1
1: 0
2: 2
3: 7
4: 155
1164309987_1164309991 -5 Left 1164309987 19:24037140-24037162 CCAGTCTTTCCAGCTACCATGCA 0: 1
1: 0
2: 4
3: 25
4: 351
Right 1164309991 19:24037158-24037180 ATGCACTGTCCCCCACTCACGGG 0: 1
1: 0
2: 2
3: 7
4: 155
1164309984_1164309991 25 Left 1164309984 19:24037110-24037132 CCCTGCCTGAATCAGTATCTGTA 0: 1
1: 0
2: 1
3: 18
4: 239
Right 1164309991 19:24037158-24037180 ATGCACTGTCCCCCACTCACGGG 0: 1
1: 0
2: 2
3: 7
4: 155
1164309986_1164309991 20 Left 1164309986 19:24037115-24037137 CCTGAATCAGTATCTGTAGCATA 0: 1
1: 0
2: 3
3: 17
4: 140
Right 1164309991 19:24037158-24037180 ATGCACTGTCCCCCACTCACGGG 0: 1
1: 0
2: 2
3: 7
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164309991 Original CRISPR ATGCACTGTCCCCCACTCAC GGG Intronic
900574754 1:3377567-3377589 GTCCACTGTCTCCCACTCCCCGG - Intronic
903265648 1:22156445-22156467 GAGCACTGTCCCCCAGTCAGTGG - Intergenic
903353267 1:22730881-22730903 CTGCTCTGTCCCTCACTCTCTGG - Intronic
904451732 1:30617268-30617290 ATTCACTGTCACCCACTGCCAGG - Intergenic
907451091 1:54546383-54546405 CTGCAATGTCCCACACTCACTGG - Intronic
908171800 1:61512434-61512456 ATGGTCTTCCCCCCACTCACTGG + Intergenic
910560151 1:88581630-88581652 ATGCAGGGTCCCACAATCACTGG - Intergenic
916547476 1:165819411-165819433 ATGCACCTTCCCACATTCACAGG + Intronic
918111488 1:181458715-181458737 ATGCAGTGTGCCCAAATCACAGG - Intronic
920931580 1:210393834-210393856 AAGCACTGTGCCCCAGCCACAGG - Intronic
923206028 1:231759799-231759821 ATGCCCTGTGTCCCACTCCCAGG + Intronic
923562627 1:235053032-235053054 ATGCACTGATGCCCACGCACAGG - Intergenic
924932582 1:248743847-248743869 TAGCTCTGGCCCCCACTCACCGG - Intronic
1062827779 10:585057-585079 ACGACCTGGCCCCCACTCACGGG + Intronic
1063159186 10:3407434-3407456 GTGCAATGTCGTCCACTCACAGG - Intergenic
1064107533 10:12512684-12512706 ATCCACTGTGCCACACTCCCAGG - Intronic
1069513089 10:69056654-69056676 AGGCACAGTCCCCCACCCTCAGG + Intergenic
1070104925 10:73422616-73422638 ATGCACCTTCCCACATTCACAGG - Intergenic
1070818759 10:79342495-79342517 CTGCACTCTCTCCCACTGACTGG - Intergenic
1070917607 10:80164967-80164989 ATCCACTGTCCCCATTTCACAGG + Intronic
1073045222 10:100633698-100633720 ATCCACTCTCCTCCACTTACTGG - Intergenic
1075273133 10:121070371-121070393 ATGCACTGCCCCCCACCCACAGG + Intergenic
1076830836 10:132993359-132993381 AGGCACCGTCCCCCACTCTGGGG - Intergenic
1077183174 11:1225361-1225383 CTGCCCTGTCCCCGACTGACAGG - Intronic
1077940548 11:6836675-6836697 ATGCACTGTCCTTCAATGACTGG + Intergenic
1079818568 11:25094625-25094647 CTGCTCTGTCCCCCAGCCACAGG - Intergenic
1081789301 11:45771678-45771700 AGGCGCTGTCCCCAGCTCACCGG + Exonic
1086268448 11:85029583-85029605 CTGCACTGTTCCCCACACATTGG - Intronic
1086291533 11:85315915-85315937 ATAAAATGTCCCCCAATCACAGG + Intronic
1086468395 11:87079033-87079055 TTGCTCTGTCTCACACTCACTGG + Intronic
1087369840 11:97269570-97269592 ATCCACTGAGCCCCACTCATGGG - Intergenic
1090612953 11:128488173-128488195 ATGCACAGACACCCACTCATAGG - Intronic
1092727501 12:11499926-11499948 ATGCTCTGGCTCCCACCCACAGG + Intronic
1092854186 12:12657360-12657382 CTGCAATGTCCCCTACCCACCGG - Intergenic
1095493909 12:42764532-42764554 AAGCACTGTTCCCCTATCACTGG - Intergenic
1102420737 12:112800930-112800952 ATGCACGGTTCCCCTCTCCCCGG + Intronic
1103462431 12:121115692-121115714 ATCCACTGTGCCACACTCCCTGG + Intergenic
1104965091 12:132505406-132505428 ACGCACTGTCCCTCAGTCCCTGG + Intronic
1106482138 13:30144552-30144574 ATGCAGGCTCCCACACTCACTGG + Intergenic
1110575109 13:77046905-77046927 GCGCACTCTCCCCCACCCACTGG - Intronic
1113241759 13:108345904-108345926 ATACACTGCCTACCACTCACTGG - Intergenic
1117131859 14:52695297-52695319 GTGCACTGTCCCGCACGCCCTGG - Intronic
1124272398 15:28294769-28294791 ATGCGGTGTCCCCCACCCCCAGG + Intronic
1124650578 15:31470770-31470792 ATATACTGACCTCCACTCACTGG - Intergenic
1125777550 15:42231065-42231087 ATGCACTGTTCCCCACACTAAGG + Intronic
1126276907 15:46894697-46894719 GTTCCCTGACCCCCACTCACAGG + Intergenic
1126779649 15:52128419-52128441 TGTCACTGTCCCCCACTAACAGG - Intronic
1127839441 15:62818237-62818259 ATGCTTTGTCCCCTACTCAGAGG + Intronic
1131620988 15:94067992-94068014 ATTCACTTTCCCCCACCAACTGG + Intergenic
1132786861 16:1661559-1661581 AGGGACTGGCCCCCTCTCACAGG - Intronic
1136705385 16:32183705-32183727 ATGCGGTGTCCCCCACCCCCAGG + Intergenic
1136762528 16:32745702-32745724 ATGCGGTGTCCCCCACCCCCAGG - Intergenic
1136805571 16:33124684-33124706 ATGCGGTGTCCCCCACCCCCAGG + Intergenic
1137014441 16:35361047-35361069 ATGCACTGTTCCCTACTCATGGG - Intergenic
1139576524 16:67845897-67845919 TTGCACCTTCCCCCACCCACAGG - Intronic
1139942176 16:70613250-70613272 ATGCACAGTCCTTCACTCTCCGG - Intronic
1203064684 16_KI270728v1_random:1006021-1006043 ATGCGGTGTCCCCCACCCCCAGG - Intergenic
1147456462 17:40541227-40541249 ATGCACACACCCCCACTCAATGG - Intergenic
1148195715 17:45711147-45711169 ATTTACTGTCCCCTCCTCACTGG + Intergenic
1148201159 17:45750905-45750927 ATTCAGTCTCCACCACTCACTGG - Intergenic
1157399835 18:47378037-47378059 ATGCATCGTCCCCCCCTCCCAGG - Intergenic
1159696965 18:71572620-71572642 ATGCACTTTCCCAAACTCATAGG - Intergenic
1159737589 18:72120103-72120125 ATGCACTTTCTCTCACACACAGG - Intergenic
1159763410 18:72456330-72456352 ATGCAGTGTCCTCCTCTCCCAGG + Intergenic
1160026056 18:75217138-75217160 AGGCACTTTGCCCCACACACAGG - Intronic
1160699775 19:500300-500322 ATTCCAGGTCCCCCACTCACTGG - Intronic
1160854528 19:1210503-1210525 ATGCCTTGTCCCGCTCTCACCGG + Intronic
1161852442 19:6744778-6744800 ATCCACTGTCCCCCTCCCCCAGG + Exonic
1162380234 19:10327574-10327596 CTGCACTGGCCTCCGCTCACTGG + Intronic
1164053016 19:21599103-21599125 ATGTACTGTCCCCCACTCATGGG - Intergenic
1164309991 19:24037158-24037180 ATGCACTGTCCCCCACTCACGGG + Intronic
1164475787 19:28575103-28575125 GTGCACTGTCAGCCACTCACTGG - Intergenic
1165067226 19:33236256-33236278 ACGCACAGTCCCCCAGCCACCGG - Intergenic
1165171570 19:33895501-33895523 ATGCACTGTCCCCAAGACCCAGG - Intergenic
1165543815 19:36516548-36516570 TTGCACTGTCACCCAGACACTGG - Intronic
1167152147 19:47716536-47716558 ATGCCCTCTCCCCCTCCCACAGG + Exonic
925880006 2:8344820-8344842 AGGCACTGCCCTCCACTCACAGG + Intergenic
930062731 2:47304001-47304023 ATGCAATCTCATCCACTCACTGG - Intergenic
937445739 2:121956289-121956311 GTGGGCTGCCCCCCACTCACGGG - Intergenic
938266859 2:129934159-129934181 ATGCCCCGCGCCCCACTCACCGG + Intergenic
946312493 2:218890521-218890543 ATGCACTGTGCACCAGGCACTGG + Intronic
948060311 2:235038712-235038734 ATGCTCTGTCCCCCACATATAGG + Intronic
948379508 2:237542657-237542679 CACCACTGCCCCCCACTCACCGG - Exonic
949056078 2:241928836-241928858 ACGCACTCCACCCCACTCACAGG + Intergenic
1171155015 20:22864113-22864135 CTCCACTGCCCCCCACCCACTGG + Intergenic
1171500320 20:25587852-25587874 CTGCACGGGCTCCCACTCACTGG + Intergenic
1177233473 21:18354236-18354258 ATTTACTGTGTCCCACTCACAGG + Intronic
1178729617 21:35088381-35088403 ATGCACTTTCACCCACTTAATGG - Intronic
1179115504 21:38488112-38488134 ATGCACTGTCCCAGACTTCCTGG + Intronic
1179500958 21:41808336-41808358 CTGCCCTGTGCCCCACTCAGCGG - Intronic
1183245142 22:36687618-36687640 ATGCAATGTGGCGCACTCACGGG - Intronic
1183405978 22:37630882-37630904 ATGCACTGTCCCCCGATTAAGGG + Exonic
949444841 3:4122916-4122938 ATCCACTGTCCCCCAGTGCCTGG - Intronic
950111236 3:10420053-10420075 ATGCACTGACAGCCTCTCACAGG - Intronic
954326815 3:49868507-49868529 ATGCCCTGGCCACCATTCACAGG - Intronic
954377235 3:50201613-50201635 AGGCAGCGTCCCCAACTCACAGG - Intergenic
954846489 3:53563188-53563210 ATCCTCTGTCCCCCTCCCACAGG + Intronic
955202157 3:56861191-56861213 TGGCACTGACCACCACTCACTGG - Intronic
956158327 3:66321580-66321602 GTACCCTGTCCCCCACCCACTGG - Intronic
957963024 3:87283631-87283653 AAGTAATGTCCCCCAGTCACTGG - Intergenic
959535800 3:107483562-107483584 ATGCACTTAACCCCAATCACAGG + Intergenic
960986111 3:123282161-123282183 AGGTGCTGTCCCCCACTCAGGGG + Intergenic
961814164 3:129539895-129539917 ATGCACTGCCCCCCCTTCTCTGG - Intergenic
963308755 3:143684687-143684709 ATCCACTGTCCCCAAGTCAGAGG + Intronic
965923359 3:173946723-173946745 ATTCACTGTCCTCTACTCAGTGG + Intronic
966910592 3:184557492-184557514 ATGCCCTATCCCCCACACAGGGG - Intronic
968219798 3:196928239-196928261 ATGCACTTTCTCCCCCTCAGTGG - Intronic
969310058 4:6347810-6347832 ATGCACAGCCCCCCACCCCCAGG + Intronic
969314560 4:6373794-6373816 ATGCACACTCCCACACACACAGG - Intronic
977294286 4:95193783-95193805 ATGCTCTGTCCCCTCCTCTCCGG + Intronic
980467570 4:133204866-133204888 ATGCAGTGTCCTCCTCTCCCAGG - Intronic
981047874 4:140281877-140281899 ATGCATTTTCCCCCACAAACAGG - Intronic
985830723 5:2227517-2227539 CTGCACTTTCCTCCACACACAGG - Intergenic
986081944 5:4404099-4404121 ATGCACTCTCTCACACACACAGG - Intergenic
997673519 5:135695597-135695619 ATGCACTGCCTCCCACCCACAGG + Intergenic
998151237 5:139758720-139758742 ATCCACTGTTCTCCACGCACAGG + Intergenic
999010499 5:148033356-148033378 ATGCAATGTCATCCTCTCACTGG - Intronic
999856956 5:155605544-155605566 ATTCACAGTTCCCCACTCCCTGG - Intergenic
1001893396 5:175358391-175358413 TTTCACTGTCCCCCACTACCTGG + Intergenic
1002491889 5:179584247-179584269 TTTCTTTGTCCCCCACTCACTGG + Intronic
1006098245 6:31669559-31669581 ATGCCCTGTCCTCCCCTCTCTGG - Intronic
1006517807 6:34554526-34554548 ATGCACTGTCAGCCTCTCAAAGG + Intronic
1008544521 6:52573782-52573804 TTGCTCTTTCCCCCACTCACTGG - Intronic
1014253676 6:119140483-119140505 ATTCACTTTCCCAAACTCACAGG + Intronic
1017261797 6:152396105-152396127 ATTCACTGGCCCCAACTCAAGGG - Intronic
1018161866 6:161052767-161052789 GTGTACAGTCCCCCACTCCCAGG + Intronic
1019571196 7:1713229-1713251 ATGCACTGTCTCCCACCTGCCGG - Intronic
1019729711 7:2623263-2623285 CTGCACTGCCCCCCACCCCCGGG + Intergenic
1022874174 7:34511724-34511746 ATGCTCAGTCCCTCACTTACAGG + Intergenic
1026144546 7:67735185-67735207 GTGCACTGGGCCCCATTCACTGG + Intergenic
1026532011 7:71207701-71207723 ATGAGCTGACACCCACTCACTGG + Intronic
1028200580 7:87956129-87956151 ATCCACTGTCCTGCACCCACTGG + Intronic
1028868176 7:95737083-95737105 ATGCAAAGTCCCACAGTCACTGG + Intergenic
1030654782 7:112154962-112154984 ATGCACAGCACACCACTCACTGG + Intronic
1033738199 7:144245570-144245592 ATGCACTGACTTCCACTCCCAGG + Intergenic
1033744854 7:144305383-144305405 ATGCACTGACTTCCACTCCCAGG - Intergenic
1034268602 7:149792730-149792752 GTGCTCTGTTCCCCACCCACCGG + Intergenic
1034902344 7:154915283-154915305 CTGCACTGCCCCCCACACCCGGG + Intergenic
1035352453 7:158256229-158256251 AAGCTCTGTCCCCCACACAATGG + Intronic
1035678041 8:1468625-1468647 ATGCACTGGCCCCAAAGCACAGG - Intergenic
1035883482 8:3267728-3267750 ATGTAGTGTGCCCCACCCACCGG - Intronic
1037808109 8:22069585-22069607 ACGCTCAGTCCCCCACTCTCTGG + Intronic
1039382752 8:37101221-37101243 AGGCACTGTCCCATAATCACAGG + Intergenic
1040294241 8:46141059-46141081 AGGCACTGTCCTCCAATGACTGG + Intergenic
1040646327 8:49401559-49401581 ACGCACCGCCCCCCACTCCCCGG + Intergenic
1046323862 8:112614511-112614533 TTTCAATGTCCCCCACTCCCAGG + Intronic
1048260408 8:132940243-132940265 GTGTTCTGTCCACCACTCACTGG + Intronic
1049873954 8:145003198-145003220 GTGCACTGTCCCCCTCTCTCGGG + Intergenic
1053584059 9:39437754-39437776 CTCCTCTGTCCCCCACTCAAAGG + Intergenic
1054105640 9:60996498-60996520 CTCCTCTGTCCCCCACTCAAAGG + Intergenic
1056637357 9:88342297-88342319 ATGCACTATCAACCACTCTCTGG - Intergenic
1057691753 9:97292154-97292176 AGGCTCTGCCCCCAACTCACAGG - Intergenic
1059051802 9:110934355-110934377 ATGCACTATCCCCCATTAAAGGG - Intronic
1060244253 9:121930774-121930796 ATACACTGTCCACGCCTCACAGG + Intronic
1062464858 9:136676443-136676465 AGGCCCTGTCCCCAACTCAGTGG + Intronic
1062626961 9:137447770-137447792 CTGCTCTGTCCCCCAGCCACGGG + Exonic
1203736535 Un_GL000216v2:143764-143786 AAGCCCTGTTCCCCACACACCGG - Intergenic
1189144243 X:38639338-38639360 ATCCCCTCTCCACCACTCACAGG - Intronic
1192435059 X:71137922-71137944 ATGGACTGACCTCCACTCAAAGG + Exonic
1194331627 X:92590607-92590629 ATGCACTGTAGCCCTGTCACAGG + Intronic
1195731680 X:107974678-107974700 ATGCAATGTCCTGCAGTCACAGG + Intergenic
1196357502 X:114810799-114810821 AGCAATTGTCCCCCACTCACAGG - Intronic
1196654983 X:118208611-118208633 ATGCAGTGTCTCTCACTCAGCGG - Intergenic
1199537311 X:148917297-148917319 ATGCACTAACCCCCATTCATAGG - Intronic
1200640333 Y:5709663-5709685 ATGCACTGTAGCCCTGTCACAGG + Intronic