ID: 1164310981

View in Genome Browser
Species Human (GRCh38)
Location 19:24046048-24046070
Sequence CTGGTAGGAAACAGTATTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 926
Summary {0: 1, 1: 0, 2: 7, 3: 44, 4: 874}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164310977_1164310981 -4 Left 1164310977 19:24046029-24046051 CCTACATATTCTAAAGAAGCTGG 0: 1
1: 1
2: 0
3: 15
4: 144
Right 1164310981 19:24046048-24046070 CTGGTAGGAAACAGTATTTTGGG 0: 1
1: 0
2: 7
3: 44
4: 874

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164310981 Original CRISPR CTGGTAGGAAACAGTATTTT GGG Intronic
900732797 1:4273693-4273715 CTTGTAGGTAACAGAATTTGTGG - Intergenic
901350758 1:8593769-8593791 CTGGTAGCAAACAGTCCTATTGG + Intronic
903406036 1:23097084-23097106 CTGTGAGGAAACAGCATTCTAGG - Intronic
904108660 1:28107493-28107515 CTGCTGAGAAACAGTATTTGAGG + Intergenic
904523820 1:31116656-31116678 CAAGAAGGACACAGTATTTTTGG - Intergenic
907134512 1:52127098-52127120 GTGATGGGAAACAGTGTTTTAGG + Intergenic
907716963 1:56934899-56934921 CTGGTAGGAAAATGCCTTTTTGG - Intronic
908219728 1:61993071-61993093 GTGGTGGGAGACAGTATTGTGGG - Intronic
908798151 1:67851864-67851886 AGGGAAGGAAACAGTTTTTTTGG + Intergenic
910051251 1:82976696-82976718 TGAGTAGGAATCAGTATTTTTGG + Intergenic
910287667 1:85573629-85573651 ATGATAGGAAACACTTTTTTAGG - Intronic
910662503 1:89688825-89688847 CTGGTAGGAAGCTGTATCATTGG + Intronic
911089231 1:94004745-94004767 ATGGGAGGAAACAGTACTTCTGG - Intronic
911835486 1:102614086-102614108 TTGGTAGGAAAAACTCTTTTTGG - Intergenic
912385267 1:109268307-109268329 CTGGGAGGAAGCAGTATCTCAGG + Intronic
913546524 1:119874294-119874316 CTGATAGGAAACTGAATTTGGGG - Intergenic
913557418 1:119981733-119981755 CTGATAGGAAACCGAATTTGGGG + Intronic
913819561 1:123038764-123038786 CAGTTAGGAAACAGTCTGTTTGG + Intergenic
913930389 1:124954216-124954238 CAGTTTGGAAACAGTCTTTTTGG - Intergenic
914424807 1:147565982-147566004 ATTGTAAGAAACAGTAGTTTGGG - Intronic
915485770 1:156219542-156219564 CTTGTAGGAAACCTTATGTTTGG + Intronic
915592454 1:156878507-156878529 CTAGTAGGAAAGGGCATTTTTGG + Intronic
916354588 1:163890629-163890651 GTGATAGGAATGAGTATTTTTGG - Intergenic
917069846 1:171138492-171138514 CTGGTATGAAATAGTTTTTTTGG - Intronic
917354196 1:174108950-174108972 CTGGTAAGAAAGAGGATTGTGGG + Intergenic
918500426 1:185188922-185188944 CTTGTGGGAAACATTATCTTTGG + Intronic
921928334 1:220732223-220732245 ATGGCAGGATACAGTGTTTTGGG - Intergenic
922366735 1:224872321-224872343 ATGGTAGAGAGCAGTATTTTGGG + Intergenic
924630195 1:245730518-245730540 CTGGTAGGCAACAGAACATTGGG - Intergenic
924785927 1:247199592-247199614 CTGTCAGGAAACAGTATTTTGGG - Intergenic
1064580030 10:16784798-16784820 CTGGTAGGTAACTGTATCATGGG - Intronic
1066003073 10:31122714-31122736 ATGGTAGGAAAAAATATTTGTGG - Intergenic
1066785606 10:39000735-39000757 CAGGTTGGAAACACTCTTTTAGG - Intergenic
1066785669 10:39001396-39001418 CAGGTTGGAAACACTCTTTTTGG - Intergenic
1066785759 10:39002431-39002453 CAGGTGGGAAACACTCTTTTTGG - Intergenic
1066786279 10:39007398-39007420 CAGGTTGGAAACACTATTTTTGG - Intergenic
1066786471 10:39009788-39009810 CAGGCAGGAAACACTCTTTTTGG - Intergenic
1066786505 10:39010132-39010154 CAGGTTGGAAACACTGTTTTTGG - Intergenic
1066786814 10:39013606-39013628 CAGGTTGGAAACACTCTTTTTGG - Intergenic
1066786901 10:39014424-39014446 CAGGTTGGAAACACTGTTTTTGG - Intergenic
1066786915 10:39014595-39014617 CAGGTTGGAAACACTCTTTTTGG - Intergenic
1066787238 10:39018541-39018563 CTGGTTGGAAACACTCTTTTTGG - Intergenic
1066787572 10:39022472-39022494 CAGGTTGGAAACACTCTTTTGGG - Intergenic
1066790396 10:39055999-39056021 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1066790490 10:39057202-39057224 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1066791024 10:39063790-39063812 CAGGTTGGAAACACTCTTTTTGG - Intergenic
1066791483 10:39069323-39069345 CAGGTTGGAAACAGTCTTTCTGG + Intergenic
1066791580 10:39070520-39070542 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1066791667 10:39071714-39071736 CTGGTTGAAAACAATCTTTTTGG + Intergenic
1066791735 10:39072555-39072577 CAGGTTGGAAACACTGTTTTTGG + Intergenic
1066791768 10:39072908-39072930 CAGGTAAGAAACACTATTTTTGG + Intergenic
1066792023 10:39075941-39075963 CAGGTTGGAAACACTGTTTTAGG + Intergenic
1066792055 10:39076284-39076306 CAGGTTGGAAACAGTCTTTGTGG + Intergenic
1066792191 10:39077928-39077950 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1066792709 10:39083474-39083496 CATGTTGGAAACACTATTTTTGG + Intergenic
1066792979 10:39086511-39086533 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1066792997 10:39086804-39086826 CAGGTTGGAAACACTGTTTTTGG + Intergenic
1066793170 10:39088811-39088833 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1066793398 10:39091390-39091412 CAGGTTGGAAACACTGTTTTTGG + Intergenic
1066793463 10:39092225-39092247 CTGGTTGGAAACATTGTTTTTGG + Intergenic
1066793783 10:39096075-39096097 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1066793997 10:39098473-39098495 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1066794087 10:39099668-39099690 CAGGTTGGAAACACTATTTTTGG + Intergenic
1066794123 10:39100010-39100032 CAGGTTGGAAACACTGTTTTTGG + Intergenic
1066794308 10:39102056-39102078 CAGGTGGGAAACACTATTTTTGG + Intergenic
1066794321 10:39102229-39102251 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1066794439 10:39103643-39103665 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1066794574 10:39105130-39105152 CAGGTTGGAAACAATCTTTTTGG + Intergenic
1066795656 10:39117452-39117474 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1066795717 10:39118262-39118284 CAGGTTGGAAACACTGTTTTCGG + Intergenic
1066795807 10:39119289-39119311 GAGGTTGGAAACAGTCTTTTTGG + Intergenic
1066795919 10:39120416-39120438 TAGGTTGGAAACACTATTTTTGG + Intergenic
1066795935 10:39120590-39120612 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1066796380 10:39126230-39126252 CAGGTTGGAAACACTATTTTTGG + Intergenic
1066796427 10:39126744-39126766 CAGATAGGAAACATTCTTTTTGG + Intergenic
1066796561 10:39128288-39128310 CTGGTAGTAAACACTATTCTTGG + Intergenic
1066796938 10:39132616-39132638 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1066797195 10:39135636-39135658 CAGGTTGGAAACACTGTTTTTGG + Intergenic
1066797327 10:39137172-39137194 CTGGTTGGAAACACTCTTTGTGG + Intergenic
1066927904 10:41720682-41720704 CAGGTTGGAAACACTGTTTTTGG + Intergenic
1066928418 10:41726689-41726711 CAGGTTGGAAAAATTATTTTTGG + Intergenic
1066928673 10:41729508-41729530 CAGGTTGGAAACATTCTTTTTGG + Intergenic
1066928885 10:41731874-41731896 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1066928922 10:41732390-41732412 CAGGTTGGAAACACTTTTTTGGG + Intergenic
1066928951 10:41732732-41732754 CAGGGAGGAAACACTCTTTTTGG + Intergenic
1066929263 10:41736319-41736341 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1066929466 10:41738896-41738918 CAGGTTGGAAACAGTCTTTTTGG + Intergenic
1066929599 10:41740438-41740460 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1066929710 10:41741976-41741998 CAGTTTGGAAACAGTGTTTTTGG + Intergenic
1066930885 10:41756769-41756791 CTGTTTGGAAACACTGTTTTTGG + Intergenic
1066934806 10:41815116-41815138 CAGTTTGGAAACAGTCTTTTTGG - Intergenic
1066934829 10:41815460-41815482 CAGTTTGGAAACAGTCTTTTTGG - Intergenic
1066934840 10:41815632-41815654 CAGTTTGGAAACAGTCTTTTTGG - Intergenic
1066934856 10:41815964-41815986 CAGTTTGGAAACAGTCTTTTTGG - Intergenic
1066934922 10:41817343-41817365 CAGTTTGGAAACAGTCTTTTTGG - Intergenic
1067056906 10:43057792-43057814 CAGGGAAGTAACAGTATTTTTGG - Intergenic
1070036366 10:72729162-72729184 GTGATAGAAAACTGTATTTTAGG + Intronic
1071237858 10:83670170-83670192 CAGGTAGGACACAGGATTTTAGG - Intergenic
1072240268 10:93489445-93489467 CTGGAAGGAAACATGATCTTGGG - Intergenic
1072966480 10:99977876-99977898 CTGGAAGGTAAAACTATTTTTGG - Intronic
1074539278 10:114351409-114351431 CTGGAAGGAAACAGTAAATCTGG - Intronic
1074920726 10:118007743-118007765 ATGGAAGAAATCAGTATTTTGGG + Exonic
1075538882 10:123295634-123295656 GTTGTAGGATGCAGTATTTTTGG + Intergenic
1076483637 10:130801607-130801629 CTGGCTGGAAATAGGATTTTAGG - Intergenic
1079041731 11:17065701-17065723 CATGAAGGAATCAGTATTTTAGG + Intergenic
1082297583 11:50461107-50461129 CTGTTTGGAAACACTGTTTTTGG + Intergenic
1082313316 11:50682881-50682903 CAGTTTGGAAACAGTCTTTTTGG + Intergenic
1082600664 11:55148782-55148804 CAGTTTGGAAACAGTCTTTTTGG - Intergenic
1082955071 11:58862075-58862097 TTTGTTGGGAACAGTATTTTTGG + Intronic
1085087007 11:73675177-73675199 CAGATAGTAAACAGTTTTTTGGG + Intergenic
1087438275 11:98150929-98150951 CTAGGAGGAAAAATTATTTTTGG + Intergenic
1088292442 11:108255325-108255347 AGGGTAGGAAACGGCATTTTAGG - Intronic
1088834490 11:113566560-113566582 CTGGTAGCAACCAGTAATATGGG + Intergenic
1088901079 11:114117829-114117851 CTGGCAGAAAACAGTATTTTTGG + Intronic
1094726355 12:33121251-33121273 CTTGTAGGCAACAGACTTTTGGG + Intergenic
1094866992 12:34546429-34546451 CTGTTTGGAAACACTGTTTTTGG - Intergenic
1094868728 12:34573771-34573793 CTGTTTGGAAACACTTTTTTTGG - Intergenic
1095065966 12:37775219-37775241 CAGCTTGGAAACAGTCTTTTTGG + Intergenic
1095066528 12:37784603-37784625 CAGTTTGGAAACAGTCTTTTTGG + Intergenic
1095068042 12:37807921-37807943 CAGTTTTGAAACAGTATTTTTGG + Intergenic
1095076010 12:37926588-37926610 CAGTTTGGAAACATTATTTTTGG - Intergenic
1095080086 12:37989380-37989402 CAGGTTGGAAACACTGTTTTTGG + Intergenic
1095080165 12:37990238-37990260 CAGGTTGGATACACTATTTTTGG + Intergenic
1095080335 12:37992277-37992299 CAGGTTGGAAACATTATTTTTGG + Intergenic
1095081254 12:38002198-38002220 CAGGTTGGAAACAGTCTTTTTGG + Intergenic
1095081519 12:38005300-38005322 CTGGTTGGAAACACTCTTTTTGG + Intergenic
1095081619 12:38006492-38006514 CAGGTTGGAAACAGTCTTTTTGG + Intergenic
1095081879 12:38010745-38010767 CAGGTTGGAAACATTCTTTTTGG + Intergenic
1096899375 12:54859142-54859164 GTGTTAGAAAAGAGTATTTTAGG - Intergenic
1098257487 12:68632096-68632118 CATGAAGGAAACAGTTTTTTGGG + Intronic
1098404677 12:70111073-70111095 TTGGTCGGATATAGTATTTTTGG - Intergenic
1099771502 12:87064468-87064490 CTCCTAGGAAATAGCATTTTGGG - Intergenic
1099976426 12:89550373-89550395 CTGGCAGGAAATAGAATTATGGG - Intergenic
1100576993 12:95901319-95901341 GGGGTAGGAAAGAGTATATTAGG + Intronic
1101917800 12:108909617-108909639 ATGGGATGAAACAGTATCTTAGG - Intergenic
1105082989 13:16147833-16147855 CAGTTTGGATACAGTATTTTTGG + Intergenic
1105229996 13:18484920-18484942 CTGTCAGTAAAAAGTATTTTGGG - Intergenic
1105308400 13:19185048-19185070 CTTGTAGTAAACAGTATTTCTGG + Intronic
1106441690 13:29779739-29779761 CAGGTATAAAACAGTATTGTGGG + Intronic
1108693955 13:52886289-52886311 CTGGTGTGAAACAGAAGTTTGGG + Intergenic
1108700606 13:52941015-52941037 CTGGTAGGAAACAGCTATCTCGG + Intergenic
1110277982 13:73661072-73661094 GTGGGAGGAAACAGAATTGTGGG + Intergenic
1110647968 13:77910966-77910988 CTGGTAGGAAAATATATTTGAGG - Intronic
1112497883 13:99919212-99919234 CTGGAAGGTGACAGTATTTTGGG - Intergenic
1113052714 13:106231689-106231711 TTGGTAGCAAACATTTTTTTGGG + Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1115675002 14:35663217-35663239 CAGGTATCAAACAGTATGTTAGG + Intronic
1116455367 14:45115083-45115105 ATGGTAGGAAACAGTATCTGTGG - Exonic
1117140083 14:52781008-52781030 CTAGTAGGAAACAAACTTTTGGG - Intronic
1119015337 14:71045718-71045740 CTGGTAGGACACAGTGTCTCTGG - Intronic
1119830358 14:77696719-77696741 CTGGTAGGAGAGAGTAGTATAGG + Intronic
1121121428 14:91378166-91378188 CAGATAGGAAACAGTAGTTGAGG + Intronic
1121256477 14:92534036-92534058 CTGATTCCAAACAGTATTTTTGG - Intronic
1123228156 15:17069863-17069885 CAGATTGGAAACAGTCTTTTTGG - Intergenic
1127711185 15:61599888-61599910 ATGGAAGGAAGCAGTATTTGTGG + Intergenic
1127882387 15:63169760-63169782 CTAGGAGAAAACATTATTTTAGG + Intergenic
1128157887 15:65403280-65403302 CTGGTACAAAACAATATGTTTGG + Intronic
1128179618 15:65590305-65590327 CAGTTAGGAAACTATATTTTAGG - Intronic
1129534438 15:76300580-76300602 TTGGTAGGAAGCAGAATTGTAGG - Intronic
1131099679 15:89678191-89678213 CTTATAGGAAACATTATTCTTGG - Intronic
1132134046 15:99315461-99315483 ATGGTGGGAAACAGAATTCTAGG + Intronic
1133640721 16:7714719-7714741 CAGGTATAAACCAGTATTTTAGG - Intergenic
1133993013 16:10725197-10725219 CAGGTAGGAAACAGCATGGTGGG + Intergenic
1134315567 16:13115760-13115782 CTGGTATGAACCAGTATAATGGG - Intronic
1136657872 16:31723125-31723147 CTGACAGGAAACAGTATTTGGGG + Intronic
1136663625 16:31789036-31789058 CTGGCAGGATACAAAATTTTTGG + Intronic
1136742639 16:32552042-32552064 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1136742746 16:32553248-32553270 CAGGTTGGAAACACTGTTTTTGG + Intergenic
1136742766 16:32553419-32553441 CAGGTTGGAAACACCATTTTTGG + Intergenic
1136743366 16:32560116-32560138 CAGGTTGGAAACACTGTTTTTGG + Intergenic
1136743390 16:32560466-32560488 CAGGTTGGAAACAGTCTTTTTGG + Intergenic
1136743878 16:32565819-32565841 CTGGTTGGAGCCACTATTTTAGG + Intergenic
1136743897 16:32565990-32566012 CTGGTTGGAAACATTCTCTTTGG + Intergenic
1136744025 16:32567361-32567383 CTGGTAGGAAACACTCTTTTTGG + Intergenic
1136744620 16:32574616-32574638 CAGGTTGGAAACACTGTTTTTGG + Intergenic
1136745127 16:32580138-32580160 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1137072726 16:35919785-35919807 CAGGTTGGAAACACTCTTTTTGG - Intergenic
1203024948 16_KI270728v1_random:500291-500313 CAGGTTGGAAACACTCTTTTTGG - Intergenic
1203024977 16_KI270728v1_random:500614-500636 CAGGTTGGAAACACTGTTTTTGG - Intergenic
1203025574 16_KI270728v1_random:507872-507894 CTGGTAGGAAACACTCTTTTTGG - Intergenic
1203025701 16_KI270728v1_random:509243-509265 CTGGTTGGAAACATTCTCTTTGG - Intergenic
1203025720 16_KI270728v1_random:509414-509436 CTGGTTGGAGCCACTATTTTAGG - Intergenic
1203026209 16_KI270728v1_random:514763-514785 CAGGTTGGAAACAGTCTTTTTGG - Intergenic
1203026233 16_KI270728v1_random:515113-515135 CAGGTTGGAAACACTGTTTTTGG - Intergenic
1203026833 16_KI270728v1_random:521810-521832 CAGGTTGGAAACACCATTTTTGG - Intergenic
1203026853 16_KI270728v1_random:521981-522003 CAGGTTGGAAACACTGTTTTTGG - Intergenic
1203026959 16_KI270728v1_random:523186-523208 CAGGTTGGAAACACTCTTTTTGG - Intergenic
1203044762 16_KI270728v1_random:811245-811267 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1203044868 16_KI270728v1_random:812450-812472 CAGGTTGGAAACACTGTTTTTGG + Intergenic
1203044888 16_KI270728v1_random:812621-812643 CAGGTTGGAAACACCATTTTTGG + Intergenic
1203045488 16_KI270728v1_random:819318-819340 CAGGTTGGAAACACTGTTTTTGG + Intergenic
1203045512 16_KI270728v1_random:819668-819690 CAGGTTGGAAACAGTCTTTTTGG + Intergenic
1203046001 16_KI270728v1_random:825017-825039 CTGGTTGGAGCCACTATTTTAGG + Intergenic
1203046020 16_KI270728v1_random:825188-825210 CTGGTTGGAAACATTCTCTTTGG + Intergenic
1203046147 16_KI270728v1_random:826559-826581 CTGGTAGGAAACACTCTTTTTGG + Intergenic
1203046744 16_KI270728v1_random:833817-833839 CAGGTTGGAAACACTGTTTTTGG + Intergenic
1203046773 16_KI270728v1_random:834140-834162 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1203047253 16_KI270728v1_random:839346-839368 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1145237085 17:21215643-21215665 CTGGGAGGTAAAAGCATTTTAGG - Intergenic
1145365548 17:22262936-22262958 CAGGTTGGAAACAATTTTTTTGG - Intergenic
1147402121 17:40186921-40186943 CAGGAAGGAAACTGTTTTTTTGG + Intronic
1148252388 17:46095222-46095244 ATGGTAGGACACATTTTTTTAGG + Intronic
1153355769 18:4133751-4133773 CATGTCAGAAACAGTATTTTGGG + Intronic
1154077503 18:11218345-11218367 CTGGAAGAAAACAGGGTTTTGGG + Intergenic
1155133859 18:22967519-22967541 CTTGTAGGTGACAGTATTATGGG - Intronic
1155271706 18:24148231-24148253 CTGGGAGGCATTAGTATTTTAGG - Intronic
1156115540 18:33782908-33782930 TTCTTAGGAAACATTATTTTAGG + Intergenic
1159037131 18:63288154-63288176 CTGTAATGAAACAGTATTTGTGG - Intronic
1160063585 18:75553610-75553632 CAGGTAAGAAACAGTATTCAAGG - Intergenic
1161017976 19:1992870-1992892 CTGGTAGTAAAATGTGTTTTGGG - Intronic
1164310981 19:24046048-24046070 CTGGTAGGAAACAGTATTTTGGG + Intronic
1164473147 19:28552546-28552568 CAGGGAGGAAAGAGTATCTTGGG - Intergenic
1165462069 19:35949816-35949838 CTGGGAGGCCACAGCATTTTGGG - Intergenic
925960450 2:9009651-9009673 CTTGTGATAAACAGTATTTTAGG - Intergenic
928791802 2:34965712-34965734 GTGGCAGGAAAAAGTATGTTCGG + Intergenic
931044205 2:58331869-58331891 CTGTTAGGAAACAAAGTTTTTGG - Intergenic
935414094 2:102797092-102797114 CTGGTAAGAAATAGTAGGTTTGG - Intronic
936111827 2:109671135-109671157 CTGGTAGGAAGCAGCAGTGTGGG - Intergenic
936834030 2:116684907-116684929 CTGTTAGGAATCAGAATTTTGGG - Intergenic
938456896 2:131472345-131472367 CTTGTAGTAAACAGTGTTTCTGG - Intronic
939707707 2:145476225-145476247 TTGGTTGGATCCAGTATTTTAGG + Intergenic
944835874 2:203579285-203579307 TTGGTAGAAACCAGTATTTCTGG - Intergenic
945273934 2:207969355-207969377 CTGGAAGTAAGCAGTATTTCTGG - Intronic
945935999 2:215903268-215903290 CTGTTAGGAAGCTGTAGTTTTGG - Intergenic
948715917 2:239863579-239863601 TTGGTAGGAGAAAGTATTCTAGG + Intergenic
1169702394 20:8461789-8461811 GTGGAAGCAAACAATATTTTTGG + Intronic
1169792576 20:9427346-9427368 CTGATAGGAGACTGTATTGTTGG - Intronic
1169908297 20:10625192-10625214 CTTAGAGCAAACAGTATTTTAGG + Exonic
1170311205 20:14994354-14994376 CTGGAAGGAAAGAGTGTGTTAGG + Intronic
1170753079 20:19169907-19169929 CTAGAAGAAAACAGTTTTTTGGG + Intergenic
1171734190 20:28753036-28753058 CAGTTTGGAAACAGTCTTTTTGG + Intergenic
1171742504 20:28915921-28915943 CAGTTTGGAAACAGTCTTTTTGG + Intergenic
1171763035 20:29229446-29229468 CAGTTTGGAAACAGTCTTTTTGG - Intergenic
1171863881 20:30460816-30460838 CAGTTCGGAAACAGTCTTTTTGG - Intergenic
1176113209 20:63419899-63419921 TTGGAAGGAAAAGGTATTTTTGG - Intronic
1176761674 21:10803017-10803039 CAGTTTGGAAACAGTCTTTTTGG - Intergenic
1176773987 21:13113266-13113288 CTGTCAGTAAAAAGTATTTTGGG - Intergenic
1178080006 21:29053412-29053434 CAGGAAGAGAACAGTATTTTAGG - Intronic
1178191359 21:30285251-30285273 ATGGAAGAAAACATTATTTTAGG - Intergenic
1178426348 21:32481983-32482005 CAGGTAGGAAATGGTACTTTAGG - Intronic
1182184283 22:28385901-28385923 CTGGAGGGAAAAAGTGTTTTTGG - Intronic
949869726 3:8578034-8578056 CTGGTATGAGACATTATGTTTGG + Intergenic
951190025 3:19757246-19757268 ATGGTAGGAAACAGTAACCTTGG + Intergenic
952045518 3:29314192-29314214 CTTGTAGGATACAGTATCATGGG - Intronic
953536413 3:43780185-43780207 CTGCTAGGAAACAGGATATATGG - Intergenic
955864052 3:63363050-63363072 ATGGTAGCAAATAGTACTTTTGG + Intronic
958199736 3:90296235-90296257 CAGTTTGGAAACAGTCTTTTTGG - Intergenic
958199757 3:90296578-90296600 CAGTTTGGAAACAGTCTTTTTGG - Intergenic
958203256 3:90350524-90350546 CAGTTTGGAAACAGTCTTTTTGG - Intergenic
958204109 3:90366891-90366913 CAAGTTGGAAACAGTCTTTTTGG - Intergenic
959328156 3:104964751-104964773 CTGGTAGGAAAGTAAATTTTTGG - Intergenic
963111185 3:141689435-141689457 CTTGTATTAAAAAGTATTTTAGG - Intergenic
963138543 3:141929475-141929497 CTGTTAGGAAGCAGAATCTTGGG - Intergenic
966506569 3:180709159-180709181 CTTTTATGAAACAGTAGTTTTGG + Intronic
967487031 3:190044949-190044971 ATGGTAGGATACAGTAATTTGGG + Intronic
970550420 4:17174817-17174839 CTTGTAGTCAACAGTATTATTGG + Intergenic
971943909 4:33250235-33250257 CTGGTTGGAAACATTATTTGTGG + Intergenic
973321327 4:48813277-48813299 CTTGTAAGAATCAGTATTGTGGG + Intronic
974235127 4:59171438-59171460 TTGGTAGAAAACAGTGTATTAGG - Intergenic
974730373 4:65856700-65856722 CTGGTAGATAAAAGCATTTTAGG - Intergenic
974806568 4:66888124-66888146 GAAGTAGGAAACAGCATTTTGGG - Intergenic
976943528 4:90736612-90736634 CTTGTAGGAAACAGATTATTAGG + Intronic
977542437 4:98333094-98333116 CAGGTATGAAATTGTATTTTTGG - Intronic
978933257 4:114343712-114343734 CTGATAGGTAGCAGTATATTTGG - Intergenic
979549289 4:121972488-121972510 CTAGTGGTAAACACTATTTTGGG + Intergenic
981017979 4:139994166-139994188 TTGGAATGAAACAGAATTTTGGG - Intronic
981809277 4:148755011-148755033 CTGGAAGGGAACTCTATTTTTGG - Intergenic
983367446 4:166811852-166811874 CTACTTGGAAACAGTATTTTAGG + Intronic
986896303 5:12373839-12373861 TTGGGAGAAAACAGTAATTTGGG + Intergenic
988660832 5:33266415-33266437 CTGGTAAGAGACAGAATTGTAGG + Intergenic
989852282 5:46228917-46228939 CTGTTTGGAAACACTGTTTTTGG + Intergenic
993982232 5:94557056-94557078 CTGGTAGGAAACATCATTTTGGG + Intronic
994410348 5:99400416-99400438 CTGGCATGGAAAAGTATTTTAGG + Intergenic
994483476 5:100364861-100364883 CTGGCATGGAAAAGTATTTTAGG - Intergenic
996365662 5:122698185-122698207 TTTTTATGAAACAGTATTTTAGG - Intergenic
997029806 5:130113828-130113850 CTGGTTTGTAGCAGTATTTTTGG - Intronic
997204096 5:132031516-132031538 CTGGTAGGAGGGAGTATTTGGGG + Intergenic
998639780 5:143996336-143996358 CTGGCTGGAAACAGCATCTTAGG + Intergenic
998740387 5:145194109-145194131 CTGGAAGGAAACAGACATTTTGG + Intergenic
999160620 5:149493879-149493901 CTGGTATAAAGCATTATTTTAGG - Intronic
999542839 5:152592465-152592487 TTGGTAGGAAAAAGCAATTTAGG + Intergenic
1000724971 5:164758244-164758266 ATAATAGAAAACAGTATTTTGGG - Intergenic
1001295282 5:170494743-170494765 CTGGGAGGAAACAGCAGTATTGG - Intronic
1001545253 5:172567145-172567167 TTGGTGGGAAACAGTTGTTTCGG - Intergenic
1004334172 6:14749158-14749180 CTGGAAAAAAACAGTATTTCAGG - Intergenic
1005697230 6:28363040-28363062 CTGGTAGGGACCAGGAATTTTGG + Intronic
1005846863 6:29788576-29788598 CTGGAAGGGAACAGTATTAAAGG - Intergenic
1008602746 6:53111851-53111873 CTGATAGGAAACTGTTTTATAGG - Intergenic
1008849338 6:56005758-56005780 TTGGTGGGAAACAGGAGTTTGGG + Intergenic
1008902556 6:56638183-56638205 CTGTTAGGAAATACTATTATGGG - Intronic
1009900340 6:69801331-69801353 CTGGCAGGAAAGAGTGTTTCAGG + Intergenic
1012662250 6:101915530-101915552 ATGGAATAAAACAGTATTTTAGG + Intronic
1013654759 6:112234825-112234847 CTGGTCTCAAACAGTATTTGTGG - Intronic
1014292687 6:119577218-119577240 TTTGTAGGATACAGTATTCTTGG - Intergenic
1015474172 6:133640849-133640871 CTGGGATGAAAAAGTCTTTTAGG - Intergenic
1016951429 6:149584365-149584387 CTGTTATGTAACAGGATTTTTGG + Intronic
1017636601 6:156450187-156450209 TTGGTAGCAAACAGTATTAGAGG - Intergenic
1018609213 6:165630649-165630671 CTGGTAGGACACGGCATATTTGG + Intronic
1021484479 7:21152413-21152435 GTGGCAGGAAAGATTATTTTAGG + Intergenic
1023180259 7:37475243-37475265 CTGATATTAAACACTATTTTGGG + Intergenic
1023303875 7:38802974-38802996 TTTGTTGGAAAAAGTATTTTAGG + Intronic
1024402948 7:48946166-48946188 CTGGTAAAAACTAGTATTTTGGG + Intergenic
1025160693 7:56657601-56657623 CTTGTAGGAAACAGATTGTTGGG - Intergenic
1025533071 7:61914622-61914644 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1025534317 7:61929286-61929308 CAGGTTGGAAACACTTTTTTTGG + Intergenic
1025534515 7:61931338-61931360 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1025535099 7:61937786-61937808 CAGGTTGTAAACACTATTTTTGG + Intergenic
1025535570 7:61944010-61944032 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1025535954 7:61948086-61948108 CAGGTTGGAAACATTGTTTTTGG + Intergenic
1025536307 7:61952548-61952570 CAGGTTGGAAACACTCTTTTTGG - Intergenic
1025726039 7:64061585-64061607 CTTGTAGGAAACAGATTGTTGGG + Intronic
1028181658 7:87731497-87731519 CTTGTAGGCAACATAATTTTGGG - Intronic
1028278628 7:88892380-88892402 CTTGTAGAAAATAGTTTTTTTGG + Intronic
1030602395 7:111607449-111607471 CTGGCAGAAAAGGGTATTTTGGG + Intergenic
1030859475 7:114606730-114606752 GTGGTAGTGAACAGAATTTTGGG + Intronic
1031260248 7:119508544-119508566 CTTGTAGGCAACATAATTTTGGG - Intergenic
1031572018 7:123370633-123370655 GTGGTTGGAAGCAGTATTTTTGG + Intergenic
1031937289 7:127748838-127748860 CTGGAAGTAAACAGTTTTTTTGG + Intronic
1033906169 7:146206428-146206450 CTGTTAGGACACAGTATTTCTGG + Intronic
1034003844 7:147446415-147446437 CTGGTTTGAAACAATATTTTTGG + Intronic
1036609520 8:10337505-10337527 CTAGTAGCACACAGTCTTTTTGG - Intronic
1036648407 8:10626122-10626144 CAGGGAGGAAACAGTTTTGTTGG + Intronic
1036762266 8:11517623-11517645 GTGGGAGGAAACAGCATGTTGGG + Intronic
1037925103 8:22838326-22838348 CTGTTAGGAAACAGGTTTTTTGG + Intronic
1039460353 8:37738331-37738353 GTAGGAGAAAACAGTATTTTAGG - Intronic
1040113159 8:43582922-43582944 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040125428 8:43732274-43732296 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040125556 8:43733644-43733666 CAGGTTGGAAACACTCTTTTGGG + Intergenic
1040126492 8:43743572-43743594 CTGGTTGGAAACCCTCTTTTTGG + Intergenic
1040126763 8:43746468-43746490 CAGGTTGGAAAAACTATTTTTGG + Intergenic
1040126842 8:43747315-43747337 CAGGTTGGAAACACTTTTTTTGG + Intergenic
1040126859 8:43747484-43747506 CAGGGAGGAAACACTTTTTTTGG + Intergenic
1040127092 8:43749936-43749958 TTGGTTGGAAACACTCTTTTTGG + Intergenic
1040127241 8:43751826-43751848 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040127272 8:43752170-43752192 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040127889 8:43759252-43759274 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040127940 8:43759934-43759956 CAGGTAGGAAACACTCTTATTGG + Intergenic
1040127968 8:43760278-43760300 CAGGTTGGAAACATTCTTTTTGG + Intergenic
1040128205 8:43763262-43763284 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040128223 8:43763434-43763456 CAGGTGGGAAACACTCTTTTTGG + Intergenic
1040128303 8:43764293-43764315 CAAGTTGGAAACAGTCTTTTTGG + Intergenic
1040128550 8:43767027-43767049 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040128653 8:43768241-43768263 CAGGTTGGAAACACTTTTTTTGG + Intergenic
1040128813 8:43770300-43770322 CAAGTTGGAAACAGTCTTTTTGG + Intergenic
1040129451 8:43777581-43777603 CAGGTAGGAAACACTATTTACGG + Intergenic
1040129932 8:43783600-43783622 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040130128 8:43785836-43785858 CAGGTTGGAAACACTGTTTTTGG + Intergenic
1040130171 8:43786353-43786375 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040130210 8:43786711-43786733 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040130269 8:43787573-43787595 CATGTTGGAAACATTATTTTTGG + Intergenic
1040130336 8:43788434-43788456 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040130366 8:43788777-43788799 CAGGTTGGAAACATTCTTTTTGG + Intergenic
1040130562 8:43791055-43791077 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040130815 8:43794343-43794365 CAGGTTGGAAACATTCTTTTTGG + Intergenic
1040130891 8:43795198-43795220 CAGATTGGAAACAGTCTTTTTGG + Intergenic
1040130917 8:43795544-43795566 CAGGTGGGAAACACTCTTTTAGG + Intergenic
1040130947 8:43795888-43795910 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040131028 8:43796909-43796931 CAGGTTGGAAACATTATTTTTGG + Intergenic
1040131095 8:43797594-43797616 CAGGTTGGAAACACTGTTTTTGG + Intergenic
1040131342 8:43800556-43800578 CAGGTAGGAAACAAGCTTTTTGG + Intergenic
1040131361 8:43800727-43800749 CAGGTTGGAAACACTTTTTTTGG + Intergenic
1040131422 8:43801406-43801428 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040131456 8:43801749-43801771 CAGGTTTGAAACACTATTTTTGG + Intergenic
1040131688 8:43804317-43804339 CAGGTTGGAAACACTGTTTTTGG + Intergenic
1040131698 8:43804475-43804497 CAGGTAGGAAACTCTCTTTTTGG + Intergenic
1040131745 8:43805007-43805029 CCGATAGGAAACACTGTTTTTGG + Intergenic
1040131804 8:43805692-43805714 CAGGTCGGAAACACTCTTTTTGG + Intergenic
1040131844 8:43806206-43806228 CAGGTAGGAAACACTCTTTTTGG + Intergenic
1040131893 8:43806713-43806735 CTGGTTGGAAACGCTATTTTTGG + Intergenic
1040132100 8:43809173-43809195 CTGGTTGGAAACACTATTTTTGG + Intergenic
1040132399 8:43812583-43812605 CAGGTTGGAAACATTCTTTTTGG + Intergenic
1040132750 8:43816323-43816345 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040132785 8:43816670-43816692 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040133475 8:43825328-43825350 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040133552 8:43826177-43826199 CAGGTTGGAAACAGTTTTTTTGG + Intergenic
1040134020 8:43831460-43831482 ACGGTTGGAAACACTATTTTTGG + Intergenic
1040134125 8:43832837-43832859 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040134421 8:43836104-43836126 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040134816 8:43840698-43840720 CAGGTTGGAAACATTCTTTTTGG + Intergenic
1040134953 8:43842398-43842420 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040135061 8:43843596-43843618 CTGGTTGGAAACACTCTTTTTGG + Intergenic
1040135155 8:43844675-43844697 CTGGTTAGAAACAATCTTTTTGG + Intergenic
1040135480 8:43848422-43848444 CAGGTTGGAAAAACTATTTTTGG + Intergenic
1040135584 8:43849788-43849810 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040135616 8:43850131-43850153 CAGGTTGGAAACACTATTTTTGG + Intergenic
1040135969 8:43854228-43854250 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040136010 8:43854741-43854763 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040136026 8:43854909-43854931 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040136460 8:43860042-43860064 CAGTTAGGAAACACTCTTTTTGG + Intergenic
1040136489 8:43860383-43860405 CAGGTTGGAAACATTCTTTTTGG + Intergenic
1040136541 8:43861020-43861042 CAGGTTGGAAACACTATTTTTGG + Intergenic
1040136609 8:43861701-43861723 CAGGGAGGAAACACTCTTTTTGG + Intergenic
1040136763 8:43863419-43863441 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040137332 8:43869952-43869974 CAGGTTGGAAACACTTTTTTTGG + Intergenic
1040137676 8:43874238-43874260 CAGGTTGGAAACACTATTCTTGG + Intergenic
1040137737 8:43874915-43874937 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040138233 8:43880411-43880433 CAGGTTGGAAACACTCTTTTTGG - Intergenic
1040139119 8:43889839-43889861 CAGGTTGGAAACACTGTTTTTGG + Intergenic
1040139188 8:43890694-43890716 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040145232 8:43983546-43983568 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040145454 8:44036881-44036903 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040146798 8:44056945-44056967 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040147015 8:44060172-44060194 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040147188 8:44062721-44062743 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040147361 8:44065270-44065292 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040147826 8:44072234-44072256 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040148529 8:44082426-44082448 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040148701 8:44084976-44084998 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040148793 8:44086333-44086355 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040149166 8:44091944-44091966 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040149338 8:44094495-44094517 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040149521 8:44097206-44097228 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040149652 8:44099074-44099096 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040149825 8:44101623-44101645 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040150489 8:44111492-44111514 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040150662 8:44114042-44114064 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040151769 8:44130522-44130544 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040151976 8:44133583-44133605 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040152069 8:44134939-44134961 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040152161 8:44136295-44136317 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040152418 8:44140034-44140056 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040152508 8:44141390-44141412 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040152631 8:44143261-44143283 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040153237 8:44152262-44152284 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040153408 8:44154810-44154832 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040153749 8:44159909-44159931 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040153918 8:44162459-44162481 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040154137 8:44165683-44165705 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040154323 8:44168396-44168418 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040154415 8:44169752-44169774 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040154541 8:44171620-44171642 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040154751 8:44174682-44174704 CAGGTTTGAAACAGTCTTTTTGG + Intergenic
1040154922 8:44177231-44177253 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040155014 8:44178587-44178609 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040155360 8:44183685-44183707 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040155450 8:44185042-44185064 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040155746 8:44189461-44189483 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040155869 8:44191329-44191351 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040155961 8:44192685-44192707 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040156052 8:44194041-44194063 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040156145 8:44195399-44195421 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040156567 8:44201691-44201713 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040156954 8:44207305-44207327 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040157046 8:44208661-44208683 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040157251 8:44211722-44211744 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040157377 8:44213590-44213612 CGGGTTGGAAACACTCTTTTTGG + Intergenic
1040157551 8:44216139-44216161 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040157643 8:44217495-44217517 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040158032 8:44223268-44223290 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040158123 8:44224624-44224646 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040158440 8:44229333-44229355 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040158532 8:44230688-44230710 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040158625 8:44232044-44232066 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040158718 8:44233400-44233422 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040158890 8:44235950-44235972 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040159106 8:44239181-44239203 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040159278 8:44241730-44241752 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040159770 8:44249046-44249068 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040160018 8:44252783-44252805 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040160222 8:44255845-44255867 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040161394 8:44273195-44273217 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040162038 8:44282709-44282731 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040162555 8:44290358-44290380 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040162757 8:44293248-44293270 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040162886 8:44295117-44295139 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040162978 8:44296474-44296496 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040163198 8:44299701-44299723 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040163290 8:44301057-44301079 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040163634 8:44306151-44306173 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040164268 8:44315508-44315530 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040164649 8:44321123-44321145 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040164740 8:44322479-44322501 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040165228 8:44329796-44329818 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040165401 8:44332346-44332368 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040165665 8:44336251-44336273 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040165837 8:44338800-44338822 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040165966 8:44340668-44340690 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040166403 8:44347125-44347147 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040166928 8:44355123-44355145 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040167399 8:44362089-44362111 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040167711 8:44366671-44366693 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040168046 8:44371602-44371624 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040168220 8:44374152-44374174 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040168634 8:44380276-44380298 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040168764 8:44382145-44382167 CAGGTTTGAAACAGTCTTTTTGG + Intergenic
1040169215 8:44388944-44388966 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040169548 8:44393880-44393902 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040170403 8:44406453-44406475 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040170493 8:44407809-44407831 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040170585 8:44409166-44409188 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040170710 8:44411035-44411057 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040170802 8:44412391-44412413 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040171432 8:44421731-44421753 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040171815 8:44427343-44427365 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040171940 8:44429213-44429235 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040172193 8:44432956-44432978 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040172321 8:44434825-44434847 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040173002 8:44444862-44444884 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040173741 8:44455760-44455782 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040173868 8:44457629-44457651 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040174460 8:44466464-44466486 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040174585 8:44468333-44468355 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040174677 8:44469690-44469712 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040175296 8:44478883-44478905 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040175387 8:44480240-44480262 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040175478 8:44481596-44481618 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040175686 8:44484658-44484680 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040175945 8:44488395-44488417 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040176220 8:44492475-44492497 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040176314 8:44493831-44493853 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040176865 8:44501991-44502013 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040177038 8:44504541-44504563 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040178947 8:44532762-44532784 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040179247 8:44537181-44537203 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040180293 8:44552826-44552848 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040180384 8:44554182-44554204 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040180476 8:44555538-44555560 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040180648 8:44558086-44558108 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040181063 8:44564216-44564238 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040181191 8:44566084-44566106 CAGGTTTGAAACAGTCTTTTTGG + Intergenic
1040181283 8:44567440-44567462 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040181500 8:44570657-44570679 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040181845 8:44575760-44575782 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040182272 8:44582052-44582074 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040183267 8:44596860-44596882 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040183718 8:44603500-44603522 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040183810 8:44604856-44604878 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040184063 8:44608598-44608620 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040184191 8:44610466-44610488 CGGGTTGGAAACACTCTTTTTGG + Intergenic
1040184281 8:44611822-44611844 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040184500 8:44615047-44615069 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040184629 8:44616915-44616937 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040184777 8:44619128-44619150 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040184870 8:44620484-44620506 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040184962 8:44621840-44621862 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040185132 8:44624389-44624411 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040185225 8:44625745-44625767 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040185844 8:44634937-44634959 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040186417 8:44643447-44643469 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040186542 8:44645314-44645336 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040186925 8:44650926-44650948 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040187643 8:44661471-44661493 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040187816 8:44664020-44664042 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040188125 8:44668599-44668621 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040188218 8:44669957-44669979 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040188390 8:44672508-44672530 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040188823 8:44678962-44678984 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040188994 8:44681510-44681532 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040189176 8:44684222-44684244 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040189488 8:44688803-44688825 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040189739 8:44692545-44692567 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040189993 8:44696287-44696309 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040190454 8:44703087-44703109 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040190718 8:44706993-44707015 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040191460 8:44718054-44718076 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040191993 8:44725879-44725901 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040192165 8:44728428-44728450 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040193732 8:44751549-44751571 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040194700 8:44765841-44765863 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040194872 8:44768393-44768415 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040195544 8:44778427-44778449 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040195706 8:44780805-44780827 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040195832 8:44782674-44782696 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040196035 8:44785737-44785759 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040196207 8:44788286-44788308 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040196336 8:44790156-44790178 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040196676 8:44795085-44795107 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040197010 8:44800019-44800041 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040197181 8:44802567-44802589 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040197593 8:44808692-44808714 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040197778 8:44811404-44811426 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040198191 8:44817525-44817547 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040198362 8:44820075-44820097 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040198452 8:44821431-44821453 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040198748 8:44825850-44825872 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040198994 8:44829586-44829608 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040199200 8:44832647-44832669 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040199573 8:44838257-44838279 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040199700 8:44840124-44840146 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040199954 8:44843866-44843888 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040200892 8:44857802-44857824 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040201242 8:44862902-44862924 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040201458 8:44866128-44866150 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040201552 8:44867483-44867505 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040202268 8:44878192-44878214 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040202448 8:44880903-44880925 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040202700 8:44884645-44884667 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040203036 8:44889574-44889596 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040203217 8:44892286-44892308 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040203639 8:44898578-44898600 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040204195 8:44906914-44906936 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040204324 8:44908782-44908804 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040204666 8:44913879-44913901 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040204883 8:44917103-44917125 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040204975 8:44918457-44918479 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040205237 8:44922363-44922385 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040205331 8:44923718-44923740 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040205424 8:44925074-44925096 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040205639 8:44928298-44928320 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040205731 8:44929655-44929677 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040205894 8:44932033-44932055 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040205985 8:44933390-44933412 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040206077 8:44934746-44934768 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040206583 8:44942227-44942249 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040206847 8:44946132-44946154 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040206939 8:44947488-44947510 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040207030 8:44948844-44948866 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040207123 8:44950201-44950223 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040207707 8:44958857-44958879 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040208122 8:44964972-44964994 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040208460 8:44970073-44970095 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040208553 8:44971429-44971451 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040208645 8:44972785-44972807 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040208739 8:44974142-44974164 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040209128 8:44979919-44979941 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040209251 8:44981787-44981809 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040209625 8:44987400-44987422 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040209716 8:44988756-44988778 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040209807 8:44990112-44990134 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040209980 8:44992658-44992680 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040210154 8:44995207-44995229 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040210335 8:44997919-44997941 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040210460 8:44999787-44999809 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040210677 8:45003011-45003033 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040210801 8:45004879-45004901 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040210977 8:45007429-45007451 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040211185 8:45010493-45010515 CAGGTTTGAAACAGTCTTTTTGG + Intergenic
1040211311 8:45012361-45012383 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040212082 8:45023740-45023762 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040212174 8:45025096-45025118 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040212300 8:45026965-45026987 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040212472 8:45029516-45029538 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040212982 8:45036992-45037014 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040213272 8:45041246-45041268 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040213642 8:45046695-45046717 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040213815 8:45049244-45049266 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040214203 8:45055017-45055039 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040214294 8:45056373-45056395 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040214595 8:45060796-45060818 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040214767 8:45063345-45063367 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040214939 8:45065894-45065916 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040215064 8:45067762-45067784 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040215237 8:45070312-45070334 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040215329 8:45071668-45071690 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040216532 8:45089522-45089544 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040216794 8:45093428-45093450 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040216889 8:45094783-45094805 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040217062 8:45097332-45097354 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040217320 8:45101075-45101097 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040217781 8:45107877-45107899 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040218193 8:45114007-45114029 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040218320 8:45115876-45115898 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040218412 8:45117232-45117254 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040218583 8:45119781-45119803 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040218755 8:45122330-45122352 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040219210 8:45129128-45129150 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040219555 8:45134219-45134241 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040219681 8:45136087-45136109 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040219774 8:45137443-45137465 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040220118 8:45142537-45142559 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040220211 8:45143893-45143915 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040220307 8:45145249-45145271 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040220767 8:45152052-45152074 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040221058 8:45156469-45156491 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040221233 8:45159019-45159041 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040221574 8:45164117-45164139 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040221705 8:45165986-45166008 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040221955 8:45169729-45169751 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040222047 8:45171085-45171107 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040222257 8:45174146-45174168 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040222351 8:45175502-45175524 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040222658 8:45180082-45180104 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040222862 8:45183143-45183165 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040222954 8:45184498-45184520 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040223047 8:45185854-45185876 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040223371 8:45190783-45190805 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040223544 8:45193333-45193355 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040223637 8:45194689-45194711 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040224053 8:45200346-45200368 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040224258 8:45203408-45203430 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040224383 8:45205276-45205298 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040225230 8:45217853-45217875 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040225494 8:45221755-45221777 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040225585 8:45223111-45223133 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040225837 8:45226852-45226874 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040225929 8:45228208-45228230 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040226060 8:45230076-45230098 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040226360 8:45234495-45234517 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040226491 8:45236363-45236385 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040226696 8:45239426-45239448 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040226789 8:45240783-45240805 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040226881 8:45242139-45242161 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040227219 8:45247072-45247094 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040227634 8:45253195-45253217 CAGGTTTGAAACAGTCTTTTTGG + Intergenic
1040227885 8:45256938-45256960 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040228172 8:45261195-45261217 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040228506 8:45266124-45266146 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040228598 8:45267480-45267502 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040228689 8:45268837-45268859 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040229444 8:45280060-45280082 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040230255 8:45291958-45291980 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040230383 8:45293828-45293850 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040230592 8:45296895-45296917 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040230985 8:45302667-45302689 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040231167 8:45305380-45305402 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040231552 8:45310994-45311016 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040231689 8:45313032-45313054 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040231862 8:45315582-45315604 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040231951 8:45316938-45316960 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040232458 8:45324416-45324438 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040233115 8:45334122-45334144 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040233206 8:45335478-45335500 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040233582 8:45341083-45341105 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040233887 8:45345438-45345460 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040233981 8:45346795-45346817 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040234072 8:45348151-45348173 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040234281 8:45351216-45351238 CAGGTTTGAAACAGTCTTTTTGG + Intergenic
1040234373 8:45352575-45352597 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040234497 8:45354443-45354465 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040234622 8:45356310-45356332 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040234807 8:45359019-45359041 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040235026 8:45362243-45362265 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040235332 8:45366660-45366682 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040235582 8:45370398-45370420 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040235831 8:45374136-45374158 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040236264 8:45380423-45380445 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040236391 8:45382291-45382313 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040236782 8:45388065-45388087 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040236906 8:45389933-45389955 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040237297 8:45395706-45395728 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040237766 8:45402675-45402697 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040237861 8:45404031-45404053 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040238272 8:45410160-45410182 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040238364 8:45411516-45411538 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040238753 8:45417130-45417152 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040238971 8:45420355-45420377 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040239190 8:45423579-45423601 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040239573 8:45429345-45429367 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040239919 8:45434438-45434460 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040240437 8:45442082-45442104 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040240697 8:45445819-45445841 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040240949 8:45449557-45449579 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040241041 8:45450913-45450935 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040241590 8:45459071-45459093 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040241851 8:45462977-45462999 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040241948 8:45464331-45464353 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040242039 8:45465687-45465709 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040242386 8:45470780-45470802 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040242775 8:45476555-45476577 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040243076 8:45480977-45480999 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040243246 8:45483526-45483548 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040243375 8:45485395-45485417 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040243632 8:45489131-45489153 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040243725 8:45490486-45490508 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040243897 8:45493036-45493058 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040244221 8:45497791-45497813 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040244313 8:45499147-45499169 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040244405 8:45500503-45500525 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040244638 8:45503909-45503931 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040245318 8:45513935-45513957 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040245944 8:45523283-45523305 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040246514 8:45531436-45531458 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040247139 8:45540597-45540619 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040247268 8:45542470-45542492 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040247394 8:45544338-45544360 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040247519 8:45546206-45546228 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040247643 8:45548074-45548096 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040247976 8:45553008-45553030 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040248102 8:45554876-45554898 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040248541 8:45561336-45561358 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040249038 8:45568810-45568832 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040249164 8:45570677-45570699 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040249291 8:45572547-45572569 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040249464 8:45575096-45575118 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040249593 8:45576964-45576986 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040249984 8:45582737-45582759 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040250280 8:45587155-45587177 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040250623 8:45592248-45592270 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040250750 8:45594116-45594138 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040251217 8:45601078-45601100 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040251474 8:45604814-45604836 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040251602 8:45606683-45606705 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040251815 8:45609907-45609929 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040251909 8:45611263-45611285 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040252258 8:45616361-45616383 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040252350 8:45617717-45617739 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040252987 8:45627061-45627083 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040253080 8:45628417-45628439 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040253173 8:45629774-45629796 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040253299 8:45631642-45631664 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040253390 8:45632998-45633020 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040253859 8:45639964-45639986 CAGGTTTGAAACAGTCTTTTTGG + Intergenic
1040254071 8:45643026-45643048 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040254164 8:45644382-45644404 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040254296 8:45646250-45646272 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040254422 8:45648119-45648141 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040254893 8:45655086-45655108 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040255017 8:45656955-45656977 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040255144 8:45658823-45658845 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040255273 8:45660694-45660716 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040255404 8:45662563-45662585 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040255495 8:45663917-45663939 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040255621 8:45665786-45665808 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040255746 8:45667654-45667676 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040255997 8:45671391-45671413 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040256220 8:45674617-45674639 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040256350 8:45676487-45676509 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040256600 8:45680225-45680247 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040256727 8:45682094-45682116 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040256944 8:45685319-45685341 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040257163 8:45688543-45688565 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040257596 8:45694992-45695014 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040257726 8:45696861-45696883 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040258126 8:45702796-45702818 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040258255 8:45704664-45704686 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040258466 8:45707717-45707739 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040258685 8:45710941-45710963 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040258902 8:45714165-45714187 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040259285 8:45719772-45719794 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040259805 8:45727579-45727601 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040259930 8:45729448-45729470 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040260057 8:45731317-45731339 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040260184 8:45733185-45733207 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040260309 8:45735055-45735077 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040260439 8:45736923-45736945 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040260566 8:45738793-45738815 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040260691 8:45740661-45740683 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040260909 8:45743885-45743907 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040261038 8:45745754-45745776 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040261167 8:45747622-45747644 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040261293 8:45749490-45749512 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040261417 8:45751359-45751381 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040261542 8:45753227-45753249 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040261668 8:45755095-45755117 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040262424 8:45766308-45766330 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040262676 8:45770045-45770067 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040262802 8:45771915-45771937 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040263183 8:45777523-45777545 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040263312 8:45779392-45779414 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040263443 8:45781261-45781283 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040263816 8:45786866-45786888 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040264196 8:45792470-45792492 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040264288 8:45793825-45793847 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040264539 8:45797563-45797585 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040264790 8:45801302-45801324 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040265044 8:45805039-45805061 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040265169 8:45806907-45806929 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040265427 8:45810643-45810665 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040265929 8:45818118-45818140 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040266058 8:45819988-45820010 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040266308 8:45823729-45823751 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040266433 8:45825598-45825620 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040266557 8:45827467-45827489 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040266688 8:45829336-45829358 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040266937 8:45833075-45833097 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040267187 8:45836814-45836836 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040267313 8:45838682-45838704 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040267438 8:45840552-45840574 CAGGTTTGAAACAGTCTTTTTGG + Intergenic
1040267691 8:45844291-45844313 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040267817 8:45846158-45846180 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040268076 8:45849894-45849916 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040268202 8:45851762-45851784 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040268332 8:45853630-45853652 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040268678 8:45858723-45858745 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040268803 8:45860592-45860614 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040268954 8:45862799-45862821 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040269088 8:45864759-45864781 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040269463 8:45870369-45870391 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040269843 8:45875974-45875996 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040270111 8:45929937-45929959 CAGGTTTGAAACAGTCTTTTTGG + Intergenic
1040270356 8:45933673-45933695 CAGGTTGGAAACAGTCTTTTTGG + Intergenic
1040297578 8:46166456-46166478 CAGGTTGGAAACATTCTTTTTGG - Intergenic
1040297633 8:46167482-46167504 CAGGTTGGAAACACTCTTTTTGG - Intergenic
1040732319 8:50463346-50463368 CTCGTAGGAATCACTATTTTTGG + Intronic
1042492497 8:69416026-69416048 CTGATAGTAAAGAGTATGTTTGG + Intergenic
1042920805 8:73917685-73917707 TAGGGAGGAAAAAGTATTTTGGG - Intergenic
1046900324 8:119516707-119516729 TTGGTAAGAAACAATATTGTTGG + Intergenic
1046970931 8:120222709-120222731 CTTTTAAGAAACAGTTTTTTTGG + Intronic
1047317763 8:123750045-123750067 CTGGTAGTCAAGACTATTTTAGG + Intergenic
1050340170 9:4629137-4629159 CTTGTAGAAAACTCTATTTTGGG + Exonic
1050906245 9:11010617-11010639 CTGGTAGGCAACAGATTGTTGGG + Intergenic
1052636090 9:31106539-31106561 ATGATAGAAAACAGTATTTTAGG + Intergenic
1055360447 9:75484301-75484323 GTGGTAGGAAAGAGTACTTCAGG - Intergenic
1056246061 9:84696748-84696770 CTGATTGGAAAAAGCATTTTTGG + Intronic
1057793694 9:98141007-98141029 TTTTTAGGAAACAGTATTTAGGG + Intronic
1060336322 9:122726548-122726570 CTGATAGGAATCCATATTTTAGG + Intergenic
1060859200 9:126939886-126939908 GGGGAAGGAAACAGTATTCTAGG + Intronic
1203382707 Un_KI270435v1:74336-74358 CAGTTTGGAAACAGTCTTTTTGG - Intergenic
1203358535 Un_KI270442v1:189408-189430 CAGTTTGGAAACAGTCTTTTTGG - Intergenic
1185944332 X:4357631-4357653 CTTATAGGAAACAGAATTTGAGG - Intergenic
1186219330 X:7332744-7332766 CGGGATGGAAACAGTATTTCAGG + Intronic
1188265165 X:28064750-28064772 CAGATAGGAAACAGTGTCTTGGG - Intergenic
1188788826 X:34382864-34382886 CTGGTGGAAAACATTATCTTGGG - Intergenic
1191228752 X:58076501-58076523 CAGGTTGGAAACACTCTTTTTGG - Intergenic
1191270507 X:58460637-58460659 CAGTTTGGAAACAGTCTTTTTGG - Intergenic
1191271021 X:58469405-58469427 CAGTTTGGAAACAGTCTTTTTGG + Intergenic
1191574188 X:62677119-62677141 CAGTTTGGAAACAGTCTTTTTGG + Intergenic
1191584165 X:62802187-62802209 CAGGTTGGAAACACTTTTTTTGG - Intergenic
1192867402 X:75149713-75149735 CTTGTAGGAAAAAGTGTTGTAGG + Intronic
1193163329 X:78254471-78254493 CTTGTAGGCAACAGTCTATTGGG + Intergenic
1193660819 X:84255675-84255697 CTTGTAGTAAACAGAAGTTTGGG + Intergenic
1193810738 X:86047921-86047943 ATGGCGGGAAACAGTTTTTTAGG - Intergenic
1194578216 X:95639561-95639583 CTGGTGGGAAATAATTTTTTTGG + Intergenic
1197224958 X:123947696-123947718 CTGATAGGAAACAATTATTTTGG + Intergenic
1201776716 Y:17673653-17673675 CAGGTTGGAAACACTCTTTTTGG - Intergenic
1201776773 Y:17674163-17674185 CAGGTTGGAAACACTCTTTTTGG - Intergenic
1201776875 Y:17675330-17675352 TAGGTGGGAAACATTATTTTTGG - Intergenic
1201776933 Y:17676016-17676038 CAGGTTGGAAACATTCTTTTTGG - Intergenic
1201776950 Y:17676188-17676210 CAGGTTGGAAACACTCTTTTTGG - Intergenic
1201778969 Y:17697345-17697367 CAGGTTGGAAACACTCTTTTTGG - Intergenic
1201779103 Y:17698712-17698734 CAGGTTGGAAACACTCTTTTTGG - Intergenic
1201779209 Y:17699922-17699944 CAGGTTGGAAACACTCTTTTTGG - Intergenic
1201779240 Y:17700266-17700288 CTGGTTGGAAACACTCTTTTGGG - Intergenic
1201779489 Y:17703329-17703351 CAGGTTGGAAACACTGTTTTTGG - Intergenic
1201779622 Y:17705047-17705069 CAGGTTGGAAACACTCTTTTTGG - Intergenic
1201821933 Y:18200945-18200967 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1201822067 Y:18202663-18202685 CAGGTTGGAAACACTGTTTTTGG + Intergenic
1201822316 Y:18205726-18205748 CTGGTTGGAAACACTCTTTTGGG + Intergenic
1201822347 Y:18206070-18206092 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1201822453 Y:18207280-18207302 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1201822587 Y:18208647-18208669 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1201824607 Y:18229804-18229826 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1201824624 Y:18229976-18229998 CAGGTTGGAAACATTCTTTTTGG + Intergenic
1201824681 Y:18230662-18230684 TAGGTGGGAAACATTATTTTTGG + Intergenic
1201824783 Y:18231829-18231851 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1201824840 Y:18232339-18232361 CAGGTTGGAAACACTCTTTTTGG + Intergenic