ID: 1164312307

View in Genome Browser
Species Human (GRCh38)
Location 19:24056795-24056817
Sequence GTCTGTGCCCTGGTTTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 1, 2: 1, 3: 28, 4: 183}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164312304_1164312307 -3 Left 1164312304 19:24056775-24056797 CCAGGTGATGTGACTGTACTGTC 0: 1
1: 0
2: 7
3: 88
4: 336
Right 1164312307 19:24056795-24056817 GTCTGTGCCCTGGTTTCAGGAGG 0: 1
1: 1
2: 1
3: 28
4: 183
1164312303_1164312307 -2 Left 1164312303 19:24056774-24056796 CCCAGGTGATGTGACTGTACTGT 0: 1
1: 0
2: 20
3: 203
4: 883
Right 1164312307 19:24056795-24056817 GTCTGTGCCCTGGTTTCAGGAGG 0: 1
1: 1
2: 1
3: 28
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164312307 Original CRISPR GTCTGTGCCCTGGTTTCAGG AGG Intronic
900727851 1:4230057-4230079 GCCTGTCCCCTGGTTTCTGGGGG + Intergenic
901136466 1:7000054-7000076 GTCTGGGCCCTGGTACCAGCTGG + Intronic
903850112 1:26300882-26300904 GTCTGGGTCCTGGCTGCAGGAGG - Intronic
905474287 1:38214942-38214964 CCCAGTGCCCTGGTGTCAGGTGG + Intergenic
905825585 1:41023800-41023822 GTCTGTGCCCTGGGTACTGTGGG + Intergenic
906517390 1:46447842-46447864 GTCTGTGCCCAGAATTCACGGGG + Intergenic
909179451 1:72403331-72403353 CTCTCTGCCCTTGTGTCAGGGGG + Intergenic
913452640 1:119002392-119002414 GTCTGTGCGCTGGTGTTAGCGGG - Intergenic
919736157 1:200952475-200952497 GTGTGTCCCCTTGTTTCAGCTGG - Intergenic
920347380 1:205315059-205315081 GTTTGTGCTCTGGCATCAGGGGG + Intronic
920703549 1:208235578-208235600 GTTTGTTCCCTGGTCCCAGGAGG - Intronic
921587248 1:216962438-216962460 GTCTCTGCCATGCTTTCAAGTGG - Intronic
922747189 1:228050974-228050996 GTGTGTGCCCTGGTTCCTTGGGG + Intronic
924182539 1:241453570-241453592 GTCTCTTCCTTGGTTGCAGGTGG + Intergenic
924225404 1:241917725-241917747 GGCGGGGCCCTGGTTCCAGGAGG + Intergenic
924511429 1:244731370-244731392 TTTTGTGAACTGGTTTCAGGTGG + Intergenic
1063951501 10:11227328-11227350 CTCAGTGCCCTGGTTTGTGGTGG - Intronic
1064202136 10:13293859-13293881 GTCTATGCCATGATTTTAGGAGG - Intronic
1067152538 10:43748718-43748740 GTCTCAGCCCTGGTTTCTAGGGG + Intergenic
1067285298 10:44903438-44903460 GTCAGTGCCCTGTTTCAAGGAGG + Intergenic
1067789880 10:49279762-49279784 GGCTGTGACCTGGTTGCTGGGGG + Intergenic
1069021436 10:63492587-63492609 CTCTGTCTCCTGGGTTCAGGTGG - Intergenic
1069903058 10:71716977-71716999 GTCAGTGCCCTGTCTACAGGGGG - Intronic
1070767480 10:79065155-79065177 GCCTGGGCCCAGGTTTCAGGAGG - Intergenic
1071460680 10:85891592-85891614 GTCCTTTCCCTGGATTCAGGGGG - Intronic
1071990585 10:91097387-91097409 GGCTGTGCCATGGCTTCAGAGGG - Intergenic
1074951352 10:118340292-118340314 GATTGTGCACTGGTTACAGGGGG + Intronic
1076231445 10:128822961-128822983 GGCTGGGACCTGGCTTCAGGAGG + Intergenic
1076319937 10:129570429-129570451 GTCTGTGCCCACGTGTCACGAGG + Intronic
1077208353 11:1354936-1354958 GTCTGTGCCATGATTTTAAGTGG + Intergenic
1077553767 11:3216083-3216105 GCCTGAGCCCTGGTGGCAGGGGG - Intergenic
1079018035 11:16886217-16886239 GTCTGTGATCTTGTTCCAGGTGG - Intronic
1079096687 11:17515457-17515479 GCCAGTGCTCTGGTTTCTGGGGG + Intronic
1081875365 11:46404756-46404778 CTCTTTTCCCTGGTTTTAGGAGG - Intronic
1083738405 11:64694743-64694765 GTCTGGGTCCTGGGTTTAGGGGG - Intronic
1083868251 11:65470476-65470498 GTCTGTGTCCTTGGCTCAGGAGG - Intergenic
1084670840 11:70605766-70605788 TTCTTTGCTCTGGTTCCAGGAGG - Intronic
1085969676 11:81572649-81572671 GTGTGTGCCTGTGTTTCAGGAGG - Intergenic
1095699581 12:45177107-45177129 GTCTGTGGGCTGGGTTGAGGTGG - Intergenic
1099299091 12:80868818-80868840 GCCTCTGGGCTGGTTTCAGGTGG + Intronic
1103893675 12:124258651-124258673 GGCTCTGCCCAGGTTGCAGGAGG + Intronic
1104590421 12:130080320-130080342 GCCTGTGCCTTGGTTAGAGGAGG + Intergenic
1104986626 12:132601079-132601101 GGTTGTGCGCTGGTTCCAGGAGG - Intergenic
1105502307 13:20983252-20983274 GCCTCTGCACTGGGTTCAGGTGG - Exonic
1107819265 13:44271544-44271566 GTCTGTCCCCTGGATTTACGTGG - Intergenic
1109419163 13:62087822-62087844 GTCTTTGCCCCTGTCTCAGGTGG + Intergenic
1112234650 13:97624513-97624535 GTATGTCCCTTGGTTCCAGGGGG - Intergenic
1112427259 13:99313862-99313884 TTCTTTGCAGTGGTTTCAGGAGG + Intronic
1118438017 14:65789209-65789231 GGCTCTCCCCTGGTTTCTGGAGG - Intergenic
1119511221 14:75213091-75213113 GGGTGTGCTCTGGTCTCAGGAGG + Intergenic
1121863159 14:97338179-97338201 GACTGTCTCCTGGTTTCTGGGGG + Intergenic
1121863168 14:97338248-97338270 GTCTGTGCCTTGTCTTCATGTGG + Intergenic
1121922580 14:97896651-97896673 GTCTGGGCCCTGGAGTGAGGTGG + Intergenic
1122452805 14:101824775-101824797 GTGTCTGCGCTGGCTTCAGGAGG + Intronic
1125483779 15:40098434-40098456 GTGTGTGCCCTGGTTAAAGAAGG + Intronic
1128283210 15:66414502-66414524 GACTGTGCCCTGATTCCAAGAGG - Intronic
1128485854 15:68087534-68087556 GTCTGTGGCCTGTTTTTATGTGG + Intronic
1128719605 15:69938634-69938656 GTGTGTGCCATTGTTTCAGGGGG + Intergenic
1128797344 15:70475552-70475574 GTGTGTGCCCGGCTTTCAGAGGG + Intergenic
1130702410 15:86198001-86198023 GTCACTGCCTTGGTTTCAAGAGG + Intronic
1132486625 16:195841-195863 TTCTGTGCCCTAGTTAGAGGAGG - Intronic
1132556957 16:576755-576777 GTCTGTGCCCCGTTTCCAGCCGG + Intronic
1134239002 16:12490533-12490555 CTCTGAGCCCTGGTTTCTGTGGG + Intronic
1134783974 16:16924230-16924252 GTTAGTTCCCTGGTTCCAGGAGG - Intergenic
1136072090 16:27793702-27793724 GTCTGTCCCCTGGATGCAGAGGG + Intronic
1137798659 16:51242748-51242770 GGCTGTGCCAGGGTTTGAGGAGG - Intergenic
1138552232 16:57754194-57754216 GCCTGTGCCCTGGTGTGTGGGGG + Intronic
1140900805 16:79365612-79365634 GTCTGTGACCTGGTCTCAACAGG + Intergenic
1142955446 17:3518430-3518452 GTGTGTGGCCAGGTTTGAGGAGG - Intronic
1143141696 17:4744910-4744932 GTCTCTGCCCCGGTTACAGGTGG + Exonic
1143419810 17:6779936-6779958 GTCTGTGCCGTGTTTTCTGGTGG + Exonic
1144996236 17:19271140-19271162 GGCTGGGCCTTGGTCTCAGGGGG + Intronic
1147996666 17:44363473-44363495 TTCTGTTCCCTGGATTCGGGTGG - Intronic
1150265782 17:63831629-63831651 GCCTCTGCCCTGTTTTCAGTGGG - Intronic
1151760715 17:76101206-76101228 GTCTCTGCCCTGGTCTCATGAGG - Intronic
1152616394 17:81339912-81339934 GGCTGTGCAGTGGGTTCAGGTGG - Intergenic
1153904405 18:9648301-9648323 GTCTGTGTCATTGTCTCAGGTGG - Intergenic
1156561655 18:38132445-38132467 GTTTCTGCCCTGGGTGCAGGAGG - Intergenic
1161089849 19:2354270-2354292 GTCTCTGCCCTGGAGTCAGGAGG - Intronic
1161541851 19:4856634-4856656 GCCTGTGCCCTGGTCCCAGCTGG + Intronic
1164041137 19:21493681-21493703 GCCTGTCCCCTGCTTTCAGGAGG + Intergenic
1164041316 19:21494940-21494962 GACTGTGCCTTGCTTTCAGGAGG + Intergenic
1164086745 19:21909516-21909538 TCCTGTGCCCTGCTTTCAAGAGG + Intergenic
1164099702 19:22043915-22043937 GACTGTGCCCTGCTTTTAGAAGG - Intergenic
1164126770 19:22325571-22325593 ACCTGTGCCCTGCTTTCAGGTGG + Intergenic
1164172571 19:22738233-22738255 ACCTGTGCCCTACTTTCAGGAGG - Intergenic
1164180653 19:22815450-22815472 GCCTGTGCTCTGCTTTCAGGAGG + Intergenic
1164204535 19:23047232-23047254 GTCTGTGTCTTGCTTTCAGGAGG - Intergenic
1164205610 19:23056194-23056216 GCCTGTGTCCTGCTTTTAGGAGG - Intergenic
1164206479 19:23063232-23063254 GAGTGTGCCCTGCTTTCAGGAGG - Intergenic
1164227666 19:23260250-23260272 ACCTGTGCCCTGCTTTCAGGAGG - Intergenic
1164233676 19:23313574-23313596 GCCCGTGTCCTGCTTTCAGGAGG + Intronic
1164281703 19:23774785-23774807 GTCTGTGCCCTGATTTCAGGAGG + Intronic
1164303809 19:23985802-23985824 GTCTGTGCCCTGCTTTCAGTGGG - Intergenic
1164312307 19:24056795-24056817 GTCTGTGCCCTGGTTTCAGGAGG + Intronic
1164323736 19:24174193-24174215 GTCTGTGCCCTGGGTGTTGGGGG + Intergenic
1164325474 19:24187593-24187615 GCCTGCACCCTGCTTTCAGGAGG - Intergenic
1164325815 19:24190531-24190553 GTCCGTGACCTGCTTTCAGGAGG - Intergenic
1167606318 19:50482625-50482647 CTCTGTGCCTTTGTTCCAGGTGG + Exonic
1167667926 19:50833459-50833481 CACTGTGCCCTGGTTTCAAGGGG - Intronic
925055937 2:857396-857418 GCCTGGGCTCTGTTTTCAGGAGG + Intergenic
926237431 2:11056065-11056087 GCGTGTGGTCTGGTTTCAGGAGG + Intergenic
927508845 2:23631779-23631801 TTCTGAGCCTAGGTTTCAGGGGG - Intronic
930560756 2:52957400-52957422 TTCTCTGCTCTGGTCTCAGGAGG - Intergenic
930994708 2:57702328-57702350 GTCAGTGGCCTGGTCCCAGGCGG + Intergenic
931220826 2:60286401-60286423 GTCTGTGACCTGGAGTGAGGCGG - Intergenic
933112414 2:78420438-78420460 GTCTGTGCCCAGTTTGCAGATGG + Intergenic
933795077 2:85913111-85913133 TGATGTGCCCTGGTTTCATGTGG + Intergenic
935123038 2:100198716-100198738 GTCTGTGCCCTGGACTTAGCTGG + Intergenic
937388613 2:121461971-121461993 GTCTGTGCTCTGGATTCCTGTGG - Intronic
937897618 2:126990513-126990535 GTCTCTTCCCTGGTTTCAGCAGG - Intergenic
939028939 2:137047179-137047201 GTCTGCGCCAAGGTTGCAGGTGG + Intronic
939962647 2:148579037-148579059 GCCTCTCCCCTGGTTTCTGGAGG - Intergenic
940852467 2:158701604-158701626 GTCTTTACCCTGGTCTCAGCAGG - Intergenic
945928652 2:215831970-215831992 GTCAATGCCATGGTTTGAGGGGG - Intergenic
946310067 2:218878327-218878349 GGCTCTGCCCTGGTGTCAGGAGG - Intergenic
946876773 2:224137390-224137412 CTCAGTGCCCTGGACTCAGGAGG - Intergenic
947876943 2:233473975-233473997 CTTTGTGCCCTGGCTCCAGGTGG + Intergenic
948645474 2:239401228-239401250 GGCTGTGCGCAGGTTTCAGCGGG - Intronic
1169920465 20:10729729-10729751 ATCTGTGCCTTGGTTTGAGGTGG + Intergenic
1170598410 20:17822651-17822673 GTCTGTGCGGTGGCTGCAGGGGG - Intergenic
1171121439 20:22572373-22572395 GCCTGAGCCCTGATTTGAGGAGG + Intergenic
1172063299 20:32201980-32202002 GTCTCTGCTCTGGTTGCGGGAGG + Exonic
1173940306 20:46905340-46905362 GTTTGTGACCTTGTTCCAGGAGG - Intronic
1173998533 20:47357852-47357874 GCCTGTGCCCTGGATTCACAAGG - Intergenic
1175424052 20:58853320-58853342 GGCTGTTCCCCGATTTCAGGGGG - Exonic
1176080211 20:63268774-63268796 GCCAGTGTGCTGGTTTCAGGAGG - Intronic
1179072183 21:38082012-38082034 GGCTGTTCCCTATTTTCAGGAGG + Intronic
1183659195 22:39208387-39208409 GTCTGTGGCCTTGCTTAAGGAGG + Intergenic
955216614 3:56989516-56989538 GTCTGTGCCCAGGGGGCAGGGGG + Intronic
957391662 3:79580954-79580976 GCCTGTGCTCTGATTTCACGTGG - Intronic
957598902 3:82306392-82306414 GTCTGAGCTCTGCTATCAGGTGG - Intergenic
961444013 3:126970182-126970204 GTCTGTCCCCTGCTTTCCGTGGG + Intergenic
964710821 3:159669600-159669622 GTCTGTGACCTGGAGTGAGGTGG - Intronic
965461681 3:168972911-168972933 TTCTTTACCCTAGTTTCAGGGGG - Intergenic
965509783 3:169555637-169555659 GTCTGTGTCCTGTTCTCAGAAGG + Intronic
967829908 3:193909870-193909892 GTCTGTGCCCTGCTTCAAGGTGG + Intergenic
968706130 4:2078828-2078850 GTCTGTGTCCAGCTTTCAGAAGG + Intronic
969517483 4:7655661-7655683 GGCTGTGCTCTGGTTTCCGAGGG - Intronic
973724104 4:53754904-53754926 GCCTTTGCCCTGAATTCAGGTGG - Intronic
978551962 4:109937450-109937472 ATCAGTGTGCTGGTTTCAGGAGG - Intronic
985969269 5:3362306-3362328 GCCTGTGCAGTGGTTTGAGGGGG + Intergenic
986861283 5:11929166-11929188 GTAAGTGACCTGGTTTCAGAAGG + Intergenic
987134954 5:14891787-14891809 GTCTGTGGCCTGTTAGCAGGAGG + Intergenic
987606711 5:20144957-20144979 GCCTCTCCCCTGGTTTCTGGAGG - Intronic
989617427 5:43350859-43350881 GTCTCTGTCCTGGTTTTAGGTGG + Intergenic
990276543 5:54203004-54203026 TTCTATGCCATGATTTCAGGGGG + Intronic
991499422 5:67262016-67262038 GTGTGGGCTCTGGATTCAGGTGG + Intergenic
991968096 5:72110900-72110922 CTCTCTTCCCTGGTTTCAAGAGG - Intronic
994245585 5:97471927-97471949 GGCTGTGCCCTGGCTCCAGGAGG + Intergenic
996658531 5:125970778-125970800 GTCTGCACCCTGGCTTCAGAGGG + Intergenic
997335259 5:133103846-133103868 GACTGTCTCCTGGTTGCAGGAGG + Exonic
1001332757 5:170773675-170773697 AGCTGTGCCCTGGTTACAGCTGG - Intronic
1001374226 5:171239581-171239603 GTCTATGCCATTATTTCAGGAGG - Intronic
1005703629 6:28429605-28429627 GTCTGTGCCCTCATCTCAGAAGG + Intergenic
1008439297 6:51514297-51514319 ATCTGTACCCTGGGTTCAGATGG - Intergenic
1009033726 6:58091779-58091801 GTATGTGAGCTGGATTCAGGAGG - Intergenic
1009209336 6:60843486-60843508 GTATGTGAGCTGGATTCAGGAGG - Intergenic
1010037232 6:71340377-71340399 GGCTGGACCCTGGTTCCAGGAGG - Intergenic
1011614749 6:89187186-89187208 TTCTGTGGCCTGGTTTCTGGGGG + Intronic
1015183190 6:130382925-130382947 GTCTGTGGCCTGGTTCCTCGAGG + Intronic
1015589654 6:134810762-134810784 GTCTCTCCCCTAGTTTCTGGTGG - Intergenic
1016303524 6:142657980-142658002 GCCTCTCCCCTGGTTTCTGGTGG + Intergenic
1017058045 6:150455512-150455534 CTCCGTGCCCTGGTCACAGGTGG - Intergenic
1018839100 6:167506211-167506233 GTCTGTGCCATGGTGACAGCAGG - Intergenic
1019079817 6:169422683-169422705 GGCTGTGCCCTGGTACCAAGTGG + Intergenic
1020016709 7:4835680-4835702 TCCTGTGCCCAGGTTTTAGGTGG - Intronic
1020073705 7:5243782-5243804 GTCTGACCCCTGGAGTCAGGGGG - Intergenic
1020846857 7:13296284-13296306 TTCTGTGTCCTGGTTTATGGTGG + Intergenic
1020886239 7:13822288-13822310 GTCTCTCCCCTGGCTTCTGGTGG + Intergenic
1023023676 7:36032798-36032820 GTCTCTGAGCAGGTTTCAGGAGG - Intergenic
1025751878 7:64301021-64301043 GTCTGGGCCCTGATTACAAGGGG - Intergenic
1025787387 7:64656036-64656058 GCCTGTGTCCTGCTTTCAGGAGG + Intergenic
1025787776 7:64659206-64659228 TTCTGTGCCTTGCTTTCAGGAGG + Intergenic
1026254382 7:68697999-68698021 GTCTGTTCCCTTGTTGCAAGAGG - Intergenic
1029199070 7:98826747-98826769 GTCTGTGCTGTGATTTCAGCTGG - Intergenic
1029230741 7:99066304-99066326 TTCTGGGCCCTGGTTTTTGGAGG + Intronic
1029361733 7:100093077-100093099 GTCCGTGAACTGGTCTCAGGGGG - Exonic
1032260088 7:130328630-130328652 GTCTGCTCCCTGCCTTCAGGGGG - Intergenic
1032490117 7:132318176-132318198 CTCAGGGCCCTGGTTGCAGGGGG + Intronic
1035097233 7:156365542-156365564 GTGTGAGCCCTGCTTCCAGGTGG + Intergenic
1037627671 8:20622231-20622253 GGCTGGGACCTGGTTTCAAGAGG + Intergenic
1039613700 8:38938402-38938424 GCCTCTGCCCTGGTATCTGGGGG - Intronic
1040385504 8:46912619-46912641 GTCAGTGCCCAGGTTACAGACGG + Intergenic
1041923939 8:63216037-63216059 GTCTGTGACCCGGGTTCAGCAGG + Intergenic
1046770107 8:118110138-118110160 GTCTTTGCCATGCTTGCAGGTGG + Exonic
1047247072 8:123155345-123155367 ATGTGTTCCCTGGTTTCAGTGGG + Intergenic
1048178044 8:132170466-132170488 GTCTGTGCGAAAGTTTCAGGTGG - Intronic
1049302445 8:141878859-141878881 AGCTGAGCCCTGGTGTCAGGAGG - Intergenic
1050062968 9:1729759-1729781 GTCTCTCCCCTGGCTTCTGGGGG - Intergenic
1050331433 9:4549956-4549978 GTGTGTGCCCTTGTTTGAGCAGG - Intronic
1051672411 9:19524221-19524243 TTCTGTGCCTTGGTTTAAGGAGG + Intronic
1055420494 9:76135998-76136020 GTTTGTGCACTGCTTTAAGGAGG + Intronic
1056212831 9:84381174-84381196 ACCTGTGCCCTGGTGTGAGGTGG - Intergenic
1059453771 9:114387184-114387206 GTCTGTGCCCTGCCAGCAGGTGG - Intronic
1060182673 9:121545255-121545277 GACAGTGCCCTGGTGTGAGGGGG + Intergenic
1060292373 9:122315666-122315688 GTCTGGGCCCTGGCTCCAGCTGG + Intronic
1061449863 9:130662117-130662139 GTCTGTGCAATGGTTTGAGTTGG - Intergenic
1062418268 9:136465039-136465061 CTCTGTCTCCTGGGTTCAGGTGG - Intronic
1062545937 9:137063781-137063803 GCCTGTCCCCAGGTTTCAGCTGG - Exonic
1062672582 9:137720172-137720194 GACTGTGCCCTGGTGTGAAGGGG - Intronic
1203769523 EBV:41791-41813 GTCTGTGTCCTGTTTTGCGGTGG + Intergenic
1188224480 X:27580282-27580304 ATCTGTGCCCTGGTTTCAATGGG + Intergenic
1190916591 X:54815691-54815713 GTATCTGCCTTGGTTTCAGTGGG + Intronic
1192362982 X:70450819-70450841 CTCTGTCCCCTGGTTTCTGGAGG + Intronic
1195495331 X:105525072-105525094 GTCTTTGCCCTTGTATCAAGTGG - Intronic
1195923470 X:110003639-110003661 CTCGGTGCCCTGGTGTCTGGAGG + Exonic
1197122453 X:122907650-122907672 ATCTGGTCTCTGGTTTCAGGTGG - Intergenic
1198736334 X:139789485-139789507 GTTTGTGTCCTTGTTTTAGGTGG - Exonic
1199093175 X:143714137-143714159 GTGTGAGACCTGGTTTGAGGTGG - Intronic
1199215160 X:145254023-145254045 GTGTGAGACCTGGTTTGAGGTGG + Intronic
1199803104 X:151270771-151270793 GGCTGCGCCATGGTTCCAGGTGG + Intergenic
1200795772 Y:7339916-7339938 GTCTTTACACTGGTTTCCGGGGG + Intergenic
1200904495 Y:8467807-8467829 GCCTGTGCCCTGTTAACAGGAGG + Intergenic