ID: 1164326317

View in Genome Browser
Species Human (GRCh38)
Location 19:24195536-24195558
Sequence CAGTAAGAGCAGAAGTCATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164326317_1164326318 28 Left 1164326317 19:24195536-24195558 CCTTATGACTTCTGCTCTTACTG No data
Right 1164326318 19:24195587-24195609 AAAACTAACAACGAACAAAGTGG No data
1164326317_1164326319 29 Left 1164326317 19:24195536-24195558 CCTTATGACTTCTGCTCTTACTG No data
Right 1164326319 19:24195588-24195610 AAACTAACAACGAACAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164326317 Original CRISPR CAGTAAGAGCAGAAGTCATA AGG (reversed) Intergenic
No off target data available for this crispr