ID: 1164326964

View in Genome Browser
Species Human (GRCh38)
Location 19:24202293-24202315
Sequence TTGGGTCAGGGGAGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164326956_1164326964 -10 Left 1164326956 19:24202280-24202302 CCTGGGGACTGTTTTGGGTCAGG No data
Right 1164326964 19:24202293-24202315 TTGGGTCAGGGGAGGGTGGAGGG No data
1164326955_1164326964 -9 Left 1164326955 19:24202279-24202301 CCCTGGGGACTGTTTTGGGTCAG No data
Right 1164326964 19:24202293-24202315 TTGGGTCAGGGGAGGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164326964 Original CRISPR TTGGGTCAGGGGAGGGTGGA GGG Intergenic
No off target data available for this crispr