ID: 1164335919

View in Genome Browser
Species Human (GRCh38)
Location 19:24321266-24321288
Sequence AAGGAGTAGCTGAAGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164335919_1164335928 27 Left 1164335919 19:24321266-24321288 CCCTCTCCCTTCAGCTACTCCTT No data
Right 1164335928 19:24321316-24321338 ATGTCTAATTCCAGTGACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164335919 Original CRISPR AAGGAGTAGCTGAAGGGAGA GGG (reversed) Intergenic
No off target data available for this crispr