ID: 1164370253

View in Genome Browser
Species Human (GRCh38)
Location 19:27637482-27637504
Sequence AGAGACTCCCAGCCAACCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164370253_1164370256 -4 Left 1164370253 19:27637482-27637504 CCAGAGGTTGGCTGGGAGTCTCT No data
Right 1164370256 19:27637501-27637523 CTCTTTTATTAGAATGACTGGGG No data
1164370253_1164370261 30 Left 1164370253 19:27637482-27637504 CCAGAGGTTGGCTGGGAGTCTCT No data
Right 1164370261 19:27637535-27637557 TCTCTATTATTATGCAACCTGGG No data
1164370253_1164370257 5 Left 1164370253 19:27637482-27637504 CCAGAGGTTGGCTGGGAGTCTCT No data
Right 1164370257 19:27637510-27637532 TAGAATGACTGGGGTCCACCAGG No data
1164370253_1164370254 -6 Left 1164370253 19:27637482-27637504 CCAGAGGTTGGCTGGGAGTCTCT No data
Right 1164370254 19:27637499-27637521 GTCTCTTTTATTAGAATGACTGG No data
1164370253_1164370260 29 Left 1164370253 19:27637482-27637504 CCAGAGGTTGGCTGGGAGTCTCT No data
Right 1164370260 19:27637534-27637556 GTCTCTATTATTATGCAACCTGG No data
1164370253_1164370255 -5 Left 1164370253 19:27637482-27637504 CCAGAGGTTGGCTGGGAGTCTCT No data
Right 1164370255 19:27637500-27637522 TCTCTTTTATTAGAATGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164370253 Original CRISPR AGAGACTCCCAGCCAACCTC TGG (reversed) Intergenic
No off target data available for this crispr