ID: 1164375185

View in Genome Browser
Species Human (GRCh38)
Location 19:27677930-27677952
Sequence GTCTCTTCCATTAGAATGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164375177_1164375185 28 Left 1164375177 19:27677879-27677901 CCTGCAGTAGGCAAAAGTTATCT No data
Right 1164375185 19:27677930-27677952 GTCTCTTCCATTAGAATGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164375185 Original CRISPR GTCTCTTCCATTAGAATGTG GGG Intergenic
No off target data available for this crispr