ID: 1164381839

View in Genome Browser
Species Human (GRCh38)
Location 19:27742558-27742580
Sequence TAGAGACACGTGGGCAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164381839_1164381842 -7 Left 1164381839 19:27742558-27742580 CCTGGGTTGCCCACGTGTCTCTA No data
Right 1164381842 19:27742574-27742596 GTCTCTATTGTTAGACTGCCTGG No data
1164381839_1164381843 4 Left 1164381839 19:27742558-27742580 CCTGGGTTGCCCACGTGTCTCTA No data
Right 1164381843 19:27742585-27742607 TAGACTGCCTGGCATCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164381839 Original CRISPR TAGAGACACGTGGGCAACCC AGG (reversed) Intergenic
No off target data available for this crispr