ID: 1164381842

View in Genome Browser
Species Human (GRCh38)
Location 19:27742574-27742596
Sequence GTCTCTATTGTTAGACTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164381839_1164381842 -7 Left 1164381839 19:27742558-27742580 CCTGGGTTGCCCACGTGTCTCTA No data
Right 1164381842 19:27742574-27742596 GTCTCTATTGTTAGACTGCCTGG No data
1164381837_1164381842 5 Left 1164381837 19:27742546-27742568 CCCATTAGAATACCTGGGTTGCC No data
Right 1164381842 19:27742574-27742596 GTCTCTATTGTTAGACTGCCTGG No data
1164381838_1164381842 4 Left 1164381838 19:27742547-27742569 CCATTAGAATACCTGGGTTGCCC No data
Right 1164381842 19:27742574-27742596 GTCTCTATTGTTAGACTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164381842 Original CRISPR GTCTCTATTGTTAGACTGCC TGG Intergenic
No off target data available for this crispr