ID: 1164383526

View in Genome Browser
Species Human (GRCh38)
Location 19:27754784-27754806
Sequence ACAAACTACCAGCCAACCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164383526_1164383531 4 Left 1164383526 19:27754784-27754806 CCTGAGGTTGGCTGGTAGTTTGT No data
Right 1164383531 19:27754811-27754833 TTAGAATGCCTGGGGTGGTCCGG No data
1164383526_1164383535 30 Left 1164383526 19:27754784-27754806 CCTGAGGTTGGCTGGTAGTTTGT No data
Right 1164383535 19:27754837-27754859 TCTTTACAATTAGACTGCCTGGG No data
1164383526_1164383530 -1 Left 1164383526 19:27754784-27754806 CCTGAGGTTGGCTGGTAGTTTGT No data
Right 1164383530 19:27754806-27754828 TTTCATTAGAATGCCTGGGGTGG No data
1164383526_1164383528 -5 Left 1164383526 19:27754784-27754806 CCTGAGGTTGGCTGGTAGTTTGT No data
Right 1164383528 19:27754802-27754824 TTTGTTTCATTAGAATGCCTGGG No data
1164383526_1164383534 29 Left 1164383526 19:27754784-27754806 CCTGAGGTTGGCTGGTAGTTTGT No data
Right 1164383534 19:27754836-27754858 TTCTTTACAATTAGACTGCCTGG No data
1164383526_1164383529 -4 Left 1164383526 19:27754784-27754806 CCTGAGGTTGGCTGGTAGTTTGT No data
Right 1164383529 19:27754803-27754825 TTGTTTCATTAGAATGCCTGGGG No data
1164383526_1164383527 -6 Left 1164383526 19:27754784-27754806 CCTGAGGTTGGCTGGTAGTTTGT No data
Right 1164383527 19:27754801-27754823 GTTTGTTTCATTAGAATGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164383526 Original CRISPR ACAAACTACCAGCCAACCTC AGG (reversed) Intergenic
No off target data available for this crispr