ID: 1164387275

View in Genome Browser
Species Human (GRCh38)
Location 19:27783677-27783699
Sequence CTGAGGGACTGGCTGTCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164387262_1164387275 25 Left 1164387262 19:27783629-27783651 CCAGCCAACTGAATGACTTATTG No data
Right 1164387275 19:27783677-27783699 CTGAGGGACTGGCTGTCAGGGGG No data
1164387264_1164387275 21 Left 1164387264 19:27783633-27783655 CCAACTGAATGACTTATTGGAGG No data
Right 1164387275 19:27783677-27783699 CTGAGGGACTGGCTGTCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164387275 Original CRISPR CTGAGGGACTGGCTGTCAGG GGG Intergenic
No off target data available for this crispr