ID: 1164388036

View in Genome Browser
Species Human (GRCh38)
Location 19:27793693-27793715
Sequence GCCCCTCCACGCGTCCACTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 81}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164388036_1164388043 10 Left 1164388036 19:27793693-27793715 CCGCAGTGGACGCGTGGAGGGGC 0: 1
1: 0
2: 1
3: 8
4: 81
Right 1164388043 19:27793726-27793748 AGGGACCTTTGCTTGGGATGCGG 0: 1
1: 0
2: 3
3: 11
4: 169
1164388036_1164388039 -9 Left 1164388036 19:27793693-27793715 CCGCAGTGGACGCGTGGAGGGGC 0: 1
1: 0
2: 1
3: 8
4: 81
Right 1164388039 19:27793707-27793729 TGGAGGGGCTCCGTAGAGGAGGG 0: 1
1: 0
2: 2
3: 17
4: 146
1164388036_1164388038 -10 Left 1164388036 19:27793693-27793715 CCGCAGTGGACGCGTGGAGGGGC 0: 1
1: 0
2: 1
3: 8
4: 81
Right 1164388038 19:27793706-27793728 GTGGAGGGGCTCCGTAGAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 155
1164388036_1164388042 4 Left 1164388036 19:27793693-27793715 CCGCAGTGGACGCGTGGAGGGGC 0: 1
1: 0
2: 1
3: 8
4: 81
Right 1164388042 19:27793720-27793742 TAGAGGAGGGACCTTTGCTTGGG 0: 1
1: 0
2: 1
3: 6
4: 148
1164388036_1164388044 11 Left 1164388036 19:27793693-27793715 CCGCAGTGGACGCGTGGAGGGGC 0: 1
1: 0
2: 1
3: 8
4: 81
Right 1164388044 19:27793727-27793749 GGGACCTTTGCTTGGGATGCGGG 0: 1
1: 0
2: 4
3: 19
4: 169
1164388036_1164388041 3 Left 1164388036 19:27793693-27793715 CCGCAGTGGACGCGTGGAGGGGC 0: 1
1: 0
2: 1
3: 8
4: 81
Right 1164388041 19:27793719-27793741 GTAGAGGAGGGACCTTTGCTTGG 0: 1
1: 2
2: 1
3: 13
4: 160
1164388036_1164388045 12 Left 1164388036 19:27793693-27793715 CCGCAGTGGACGCGTGGAGGGGC 0: 1
1: 0
2: 1
3: 8
4: 81
Right 1164388045 19:27793728-27793750 GGACCTTTGCTTGGGATGCGGGG 0: 1
1: 0
2: 1
3: 8
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164388036 Original CRISPR GCCCCTCCACGCGTCCACTG CGG (reversed) Intergenic