ID: 1164388984

View in Genome Browser
Species Human (GRCh38)
Location 19:27801300-27801322
Sequence AACGTCAGTTAAAACTACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164388984_1164388987 12 Left 1164388984 19:27801300-27801322 CCAGAGTAGTTTTAACTGACGTT No data
Right 1164388987 19:27801335-27801357 ACACTCTTACATCTCACGGGAGG No data
1164388984_1164388985 8 Left 1164388984 19:27801300-27801322 CCAGAGTAGTTTTAACTGACGTT No data
Right 1164388985 19:27801331-27801353 TTGAACACTCTTACATCTCACGG No data
1164388984_1164388986 9 Left 1164388984 19:27801300-27801322 CCAGAGTAGTTTTAACTGACGTT No data
Right 1164388986 19:27801332-27801354 TGAACACTCTTACATCTCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164388984 Original CRISPR AACGTCAGTTAAAACTACTC TGG (reversed) Intergenic
No off target data available for this crispr