ID: 1164388985

View in Genome Browser
Species Human (GRCh38)
Location 19:27801331-27801353
Sequence TTGAACACTCTTACATCTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164388984_1164388985 8 Left 1164388984 19:27801300-27801322 CCAGAGTAGTTTTAACTGACGTT No data
Right 1164388985 19:27801331-27801353 TTGAACACTCTTACATCTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164388985 Original CRISPR TTGAACACTCTTACATCTCA CGG Intergenic
No off target data available for this crispr