ID: 1164393794

View in Genome Browser
Species Human (GRCh38)
Location 19:27846746-27846768
Sequence TTAACCTCGCATAACAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164393794_1164393799 28 Left 1164393794 19:27846746-27846768 CCAGCTTTGTTATGCGAGGTTAA No data
Right 1164393799 19:27846797-27846819 TCTGGACAAACAGATACTGGAGG No data
1164393794_1164393800 29 Left 1164393794 19:27846746-27846768 CCAGCTTTGTTATGCGAGGTTAA No data
Right 1164393800 19:27846798-27846820 CTGGACAAACAGATACTGGAGGG No data
1164393794_1164393795 10 Left 1164393794 19:27846746-27846768 CCAGCTTTGTTATGCGAGGTTAA No data
Right 1164393795 19:27846779-27846801 AACCGCATCCTATAACTGTCTGG No data
1164393794_1164393798 25 Left 1164393794 19:27846746-27846768 CCAGCTTTGTTATGCGAGGTTAA No data
Right 1164393798 19:27846794-27846816 CTGTCTGGACAAACAGATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164393794 Original CRISPR TTAACCTCGCATAACAAAGC TGG (reversed) Intergenic
No off target data available for this crispr