ID: 1164393796

View in Genome Browser
Species Human (GRCh38)
Location 19:27846781-27846803
Sequence GTCCAGACAGTTATAGGATG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164393796_1164393804 11 Left 1164393796 19:27846781-27846803 CCGCATCCTATAACTGTCTGGAC No data
Right 1164393804 19:27846815-27846837 GGAGGGCTCAGTGAAGGCAGGGG No data
1164393796_1164393807 30 Left 1164393796 19:27846781-27846803 CCGCATCCTATAACTGTCTGGAC No data
Right 1164393807 19:27846834-27846856 GGGGTTTGTCTTTTGCCCTGGGG No data
1164393796_1164393805 28 Left 1164393796 19:27846781-27846803 CCGCATCCTATAACTGTCTGGAC No data
Right 1164393805 19:27846832-27846854 CAGGGGTTTGTCTTTTGCCCTGG No data
1164393796_1164393801 5 Left 1164393796 19:27846781-27846803 CCGCATCCTATAACTGTCTGGAC No data
Right 1164393801 19:27846809-27846831 GATACTGGAGGGCTCAGTGAAGG No data
1164393796_1164393803 10 Left 1164393796 19:27846781-27846803 CCGCATCCTATAACTGTCTGGAC No data
Right 1164393803 19:27846814-27846836 TGGAGGGCTCAGTGAAGGCAGGG No data
1164393796_1164393806 29 Left 1164393796 19:27846781-27846803 CCGCATCCTATAACTGTCTGGAC No data
Right 1164393806 19:27846833-27846855 AGGGGTTTGTCTTTTGCCCTGGG No data
1164393796_1164393799 -7 Left 1164393796 19:27846781-27846803 CCGCATCCTATAACTGTCTGGAC No data
Right 1164393799 19:27846797-27846819 TCTGGACAAACAGATACTGGAGG No data
1164393796_1164393798 -10 Left 1164393796 19:27846781-27846803 CCGCATCCTATAACTGTCTGGAC No data
Right 1164393798 19:27846794-27846816 CTGTCTGGACAAACAGATACTGG No data
1164393796_1164393802 9 Left 1164393796 19:27846781-27846803 CCGCATCCTATAACTGTCTGGAC No data
Right 1164393802 19:27846813-27846835 CTGGAGGGCTCAGTGAAGGCAGG No data
1164393796_1164393800 -6 Left 1164393796 19:27846781-27846803 CCGCATCCTATAACTGTCTGGAC No data
Right 1164393800 19:27846798-27846820 CTGGACAAACAGATACTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164393796 Original CRISPR GTCCAGACAGTTATAGGATG CGG (reversed) Intergenic
No off target data available for this crispr